ID: 1068517444

View in Genome Browser
Species Human (GRCh38)
Location 10:58041873-58041895
Sequence GATTTTAGGAGGATTATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068517434_1068517444 8 Left 1068517434 10:58041842-58041864 CCAAATTCCTTAACCACAGTTTA No data
Right 1068517444 10:58041873-58041895 GATTTTAGGAGGATTATGGAGGG No data
1068517437_1068517444 1 Left 1068517437 10:58041849-58041871 CCTTAACCACAGTTTAGGGCTGT No data
Right 1068517444 10:58041873-58041895 GATTTTAGGAGGATTATGGAGGG No data
1068517439_1068517444 -5 Left 1068517439 10:58041855-58041877 CCACAGTTTAGGGCTGTGGATTT No data
Right 1068517444 10:58041873-58041895 GATTTTAGGAGGATTATGGAGGG No data
1068517433_1068517444 17 Left 1068517433 10:58041833-58041855 CCATCAAATCCAAATTCCTTAAC No data
Right 1068517444 10:58041873-58041895 GATTTTAGGAGGATTATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068517444 Original CRISPR GATTTTAGGAGGATTATGGA GGG Intergenic
No off target data available for this crispr