ID: 1068518021

View in Genome Browser
Species Human (GRCh38)
Location 10:58047956-58047978
Sequence GATCCCTATGAAGCTACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068518021_1068518023 -8 Left 1068518021 10:58047956-58047978 CCCTCAGTAGCTTCATAGGGATC No data
Right 1068518023 10:58047971-58047993 TAGGGATCCCAAGATAGAGAAGG No data
1068518021_1068518029 21 Left 1068518021 10:58047956-58047978 CCCTCAGTAGCTTCATAGGGATC No data
Right 1068518029 10:58048000-58048022 CTTGAAGAAAATTGTGGCTGTGG No data
1068518021_1068518027 15 Left 1068518021 10:58047956-58047978 CCCTCAGTAGCTTCATAGGGATC No data
Right 1068518027 10:58047994-58048016 GCCTGACTTGAAGAAAATTGTGG No data
1068518021_1068518024 -7 Left 1068518021 10:58047956-58047978 CCCTCAGTAGCTTCATAGGGATC No data
Right 1068518024 10:58047972-58047994 AGGGATCCCAAGATAGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068518021 Original CRISPR GATCCCTATGAAGCTACTGA GGG (reversed) Intergenic
No off target data available for this crispr