ID: 1068518023

View in Genome Browser
Species Human (GRCh38)
Location 10:58047971-58047993
Sequence TAGGGATCCCAAGATAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068518022_1068518023 -9 Left 1068518022 10:58047957-58047979 CCTCAGTAGCTTCATAGGGATCC No data
Right 1068518023 10:58047971-58047993 TAGGGATCCCAAGATAGAGAAGG No data
1068518020_1068518023 -7 Left 1068518020 10:58047955-58047977 CCCCTCAGTAGCTTCATAGGGAT No data
Right 1068518023 10:58047971-58047993 TAGGGATCCCAAGATAGAGAAGG No data
1068518021_1068518023 -8 Left 1068518021 10:58047956-58047978 CCCTCAGTAGCTTCATAGGGATC No data
Right 1068518023 10:58047971-58047993 TAGGGATCCCAAGATAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068518023 Original CRISPR TAGGGATCCCAAGATAGAGA AGG Intergenic
No off target data available for this crispr