ID: 1068518029

View in Genome Browser
Species Human (GRCh38)
Location 10:58048000-58048022
Sequence CTTGAAGAAAATTGTGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068518025_1068518029 -1 Left 1068518025 10:58047978-58048000 CCCAAGATAGAGAAGGGCCTGAC No data
Right 1068518029 10:58048000-58048022 CTTGAAGAAAATTGTGGCTGTGG No data
1068518021_1068518029 21 Left 1068518021 10:58047956-58047978 CCCTCAGTAGCTTCATAGGGATC No data
Right 1068518029 10:58048000-58048022 CTTGAAGAAAATTGTGGCTGTGG No data
1068518026_1068518029 -2 Left 1068518026 10:58047979-58048001 CCAAGATAGAGAAGGGCCTGACT No data
Right 1068518029 10:58048000-58048022 CTTGAAGAAAATTGTGGCTGTGG No data
1068518020_1068518029 22 Left 1068518020 10:58047955-58047977 CCCCTCAGTAGCTTCATAGGGAT No data
Right 1068518029 10:58048000-58048022 CTTGAAGAAAATTGTGGCTGTGG No data
1068518022_1068518029 20 Left 1068518022 10:58047957-58047979 CCTCAGTAGCTTCATAGGGATCC No data
Right 1068518029 10:58048000-58048022 CTTGAAGAAAATTGTGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068518029 Original CRISPR CTTGAAGAAAATTGTGGCTG TGG Intergenic
No off target data available for this crispr