ID: 1068518866

View in Genome Browser
Species Human (GRCh38)
Location 10:58057302-58057324
Sequence GCTCATGTATGTGCACTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068518866_1068518869 7 Left 1068518866 10:58057302-58057324 CCTCTTAGTGCACATACATGAGC No data
Right 1068518869 10:58057332-58057354 CCCAACTTCTGAGATATTATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068518866 Original CRISPR GCTCATGTATGTGCACTAAG AGG (reversed) Intergenic
No off target data available for this crispr