ID: 1068519128

View in Genome Browser
Species Human (GRCh38)
Location 10:58060089-58060111
Sequence TTTTAGGTGAATTTAAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068519128_1068519135 13 Left 1068519128 10:58060089-58060111 CCTTCCTTTAAATTCACCTAAAA No data
Right 1068519135 10:58060125-58060147 TAAATATGTCCATGAATGCTGGG No data
1068519128_1068519134 12 Left 1068519128 10:58060089-58060111 CCTTCCTTTAAATTCACCTAAAA No data
Right 1068519134 10:58060124-58060146 CTAAATATGTCCATGAATGCTGG No data
1068519128_1068519137 21 Left 1068519128 10:58060089-58060111 CCTTCCTTTAAATTCACCTAAAA No data
Right 1068519137 10:58060133-58060155 TCCATGAATGCTGGGTTTCAGGG No data
1068519128_1068519136 20 Left 1068519128 10:58060089-58060111 CCTTCCTTTAAATTCACCTAAAA No data
Right 1068519136 10:58060132-58060154 GTCCATGAATGCTGGGTTTCAGG No data
1068519128_1068519139 25 Left 1068519128 10:58060089-58060111 CCTTCCTTTAAATTCACCTAAAA No data
Right 1068519139 10:58060137-58060159 TGAATGCTGGGTTTCAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068519128 Original CRISPR TTTTAGGTGAATTTAAAGGA AGG (reversed) Intergenic
No off target data available for this crispr