ID: 1068519134

View in Genome Browser
Species Human (GRCh38)
Location 10:58060124-58060146
Sequence CTAAATATGTCCATGAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068519130_1068519134 8 Left 1068519130 10:58060093-58060115 CCTTTAAATTCACCTAAAAGGAT No data
Right 1068519134 10:58060124-58060146 CTAAATATGTCCATGAATGCTGG No data
1068519128_1068519134 12 Left 1068519128 10:58060089-58060111 CCTTCCTTTAAATTCACCTAAAA No data
Right 1068519134 10:58060124-58060146 CTAAATATGTCCATGAATGCTGG No data
1068519127_1068519134 23 Left 1068519127 10:58060078-58060100 CCATAAATTAACCTTCCTTTAAA No data
Right 1068519134 10:58060124-58060146 CTAAATATGTCCATGAATGCTGG No data
1068519131_1068519134 -4 Left 1068519131 10:58060105-58060127 CCTAAAAGGATAGACTGCCCTAA No data
Right 1068519134 10:58060124-58060146 CTAAATATGTCCATGAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068519134 Original CRISPR CTAAATATGTCCATGAATGC TGG Intergenic
No off target data available for this crispr