ID: 1068519136

View in Genome Browser
Species Human (GRCh38)
Location 10:58060132-58060154
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068519130_1068519136 16 Left 1068519130 10:58060093-58060115 CCTTTAAATTCACCTAAAAGGAT No data
Right 1068519136 10:58060132-58060154 GTCCATGAATGCTGGGTTTCAGG No data
1068519131_1068519136 4 Left 1068519131 10:58060105-58060127 CCTAAAAGGATAGACTGCCCTAA No data
Right 1068519136 10:58060132-58060154 GTCCATGAATGCTGGGTTTCAGG No data
1068519128_1068519136 20 Left 1068519128 10:58060089-58060111 CCTTCCTTTAAATTCACCTAAAA No data
Right 1068519136 10:58060132-58060154 GTCCATGAATGCTGGGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068519136 Original CRISPR GTCCATGAATGCTGGGTTTC AGG Intergenic
No off target data available for this crispr