ID: 1068519139

View in Genome Browser
Species Human (GRCh38)
Location 10:58060137-58060159
Sequence TGAATGCTGGGTTTCAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068519132_1068519139 -8 Left 1068519132 10:58060122-58060144 CCCTAAATATGTCCATGAATGCT No data
Right 1068519139 10:58060137-58060159 TGAATGCTGGGTTTCAGGGCTGG No data
1068519130_1068519139 21 Left 1068519130 10:58060093-58060115 CCTTTAAATTCACCTAAAAGGAT No data
Right 1068519139 10:58060137-58060159 TGAATGCTGGGTTTCAGGGCTGG No data
1068519133_1068519139 -9 Left 1068519133 10:58060123-58060145 CCTAAATATGTCCATGAATGCTG No data
Right 1068519139 10:58060137-58060159 TGAATGCTGGGTTTCAGGGCTGG No data
1068519131_1068519139 9 Left 1068519131 10:58060105-58060127 CCTAAAAGGATAGACTGCCCTAA No data
Right 1068519139 10:58060137-58060159 TGAATGCTGGGTTTCAGGGCTGG No data
1068519128_1068519139 25 Left 1068519128 10:58060089-58060111 CCTTCCTTTAAATTCACCTAAAA No data
Right 1068519139 10:58060137-58060159 TGAATGCTGGGTTTCAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068519139 Original CRISPR TGAATGCTGGGTTTCAGGGC TGG Intergenic
No off target data available for this crispr