ID: 1068520273

View in Genome Browser
Species Human (GRCh38)
Location 10:58069892-58069914
Sequence TATCCAGGCCATCCCAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068520273_1068520275 -1 Left 1068520273 10:58069892-58069914 CCACTTTTGGGATGGCCTGGATA No data
Right 1068520275 10:58069914-58069936 AGCACCTCCTTTTGTGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068520273 Original CRISPR TATCCAGGCCATCCCAAAAG TGG (reversed) Intergenic
No off target data available for this crispr