ID: 1068525770

View in Genome Browser
Species Human (GRCh38)
Location 10:58127724-58127746
Sequence CACTCCCTCCAGAGGCTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068525765_1068525770 25 Left 1068525765 10:58127676-58127698 CCTTCTGGAGGCACTTCTGAAAA No data
Right 1068525770 10:58127724-58127746 CACTCCCTCCAGAGGCTCTATGG No data
1068525764_1068525770 26 Left 1068525764 10:58127675-58127697 CCCTTCTGGAGGCACTTCTGAAA No data
Right 1068525770 10:58127724-58127746 CACTCCCTCCAGAGGCTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068525770 Original CRISPR CACTCCCTCCAGAGGCTCTA TGG Intergenic
No off target data available for this crispr