ID: 1068526890

View in Genome Browser
Species Human (GRCh38)
Location 10:58140678-58140700
Sequence ATAAACTCTTCCACTGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068526890_1068526894 20 Left 1068526890 10:58140678-58140700 CCATCTCCAGTGGAAGAGTTTAT No data
Right 1068526894 10:58140721-58140743 ACTTTGAATTTGTCCCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068526890 Original CRISPR ATAAACTCTTCCACTGGAGA TGG (reversed) Intergenic
No off target data available for this crispr