ID: 1068526893

View in Genome Browser
Species Human (GRCh38)
Location 10:58140704-58140726
Sequence CAAAGTAATTTTCATAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068526893_1068526900 26 Left 1068526893 10:58140704-58140726 CCAGGTCTATGAAAATTACTTTG No data
Right 1068526900 10:58140753-58140775 CTCCACATGTGAGATGAGAGGGG No data
1068526893_1068526894 -6 Left 1068526893 10:58140704-58140726 CCAGGTCTATGAAAATTACTTTG No data
Right 1068526894 10:58140721-58140743 ACTTTGAATTTGTCCCCTTCTGG No data
1068526893_1068526901 27 Left 1068526893 10:58140704-58140726 CCAGGTCTATGAAAATTACTTTG No data
Right 1068526901 10:58140754-58140776 TCCACATGTGAGATGAGAGGGGG No data
1068526893_1068526898 24 Left 1068526893 10:58140704-58140726 CCAGGTCTATGAAAATTACTTTG No data
Right 1068526898 10:58140751-58140773 CTCTCCACATGTGAGATGAGAGG No data
1068526893_1068526899 25 Left 1068526893 10:58140704-58140726 CCAGGTCTATGAAAATTACTTTG No data
Right 1068526899 10:58140752-58140774 TCTCCACATGTGAGATGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068526893 Original CRISPR CAAAGTAATTTTCATAGACC TGG (reversed) Intergenic
No off target data available for this crispr