ID: 1068526894

View in Genome Browser
Species Human (GRCh38)
Location 10:58140721-58140743
Sequence ACTTTGAATTTGTCCCCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068526890_1068526894 20 Left 1068526890 10:58140678-58140700 CCATCTCCAGTGGAAGAGTTTAT No data
Right 1068526894 10:58140721-58140743 ACTTTGAATTTGTCCCCTTCTGG No data
1068526891_1068526894 14 Left 1068526891 10:58140684-58140706 CCAGTGGAAGAGTTTATTGACCA No data
Right 1068526894 10:58140721-58140743 ACTTTGAATTTGTCCCCTTCTGG No data
1068526893_1068526894 -6 Left 1068526893 10:58140704-58140726 CCAGGTCTATGAAAATTACTTTG No data
Right 1068526894 10:58140721-58140743 ACTTTGAATTTGTCCCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068526894 Original CRISPR ACTTTGAATTTGTCCCCTTC TGG Intergenic
No off target data available for this crispr