ID: 1068528768

View in Genome Browser
Species Human (GRCh38)
Location 10:58161773-58161795
Sequence ATTTGTAAAATGAAGGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068528768_1068528775 -10 Left 1068528768 10:58161773-58161795 CCCACCCCCTTCATTTTACAAAT No data
Right 1068528775 10:58161786-58161808 TTTTACAAATGAGGAAACTAAGG 0: 24
1: 346
2: 2518
3: 8495
4: 17085
1068528768_1068528781 19 Left 1068528768 10:58161773-58161795 CCCACCCCCTTCATTTTACAAAT No data
Right 1068528781 10:58161815-58161837 GAGGGTAAATGACTTGCTCAAGG No data
1068528768_1068528779 1 Left 1068528768 10:58161773-58161795 CCCACCCCCTTCATTTTACAAAT No data
Right 1068528779 10:58161797-58161819 AGGAAACTAAGGCCTAGGGAGGG No data
1068528768_1068528776 -4 Left 1068528768 10:58161773-58161795 CCCACCCCCTTCATTTTACAAAT No data
Right 1068528776 10:58161792-58161814 AAATGAGGAAACTAAGGCCTAGG No data
1068528768_1068528777 -3 Left 1068528768 10:58161773-58161795 CCCACCCCCTTCATTTTACAAAT No data
Right 1068528777 10:58161793-58161815 AATGAGGAAACTAAGGCCTAGGG No data
1068528768_1068528778 0 Left 1068528768 10:58161773-58161795 CCCACCCCCTTCATTTTACAAAT No data
Right 1068528778 10:58161796-58161818 GAGGAAACTAAGGCCTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068528768 Original CRISPR ATTTGTAAAATGAAGGGGGT GGG (reversed) Intergenic
No off target data available for this crispr