ID: 1068539477

View in Genome Browser
Species Human (GRCh38)
Location 10:58274784-58274806
Sequence TCCCTTGGATTTTGTGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068539477_1068539483 18 Left 1068539477 10:58274784-58274806 CCACCATCACAAAATCCAAGGGA No data
Right 1068539483 10:58274825-58274847 AAGTGACCTGTGGGTGCAGTTGG No data
1068539477_1068539482 9 Left 1068539477 10:58274784-58274806 CCACCATCACAAAATCCAAGGGA No data
Right 1068539482 10:58274816-58274838 TAAAAAAAAAAGTGACCTGTGGG No data
1068539477_1068539481 8 Left 1068539477 10:58274784-58274806 CCACCATCACAAAATCCAAGGGA No data
Right 1068539481 10:58274815-58274837 TTAAAAAAAAAAGTGACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068539477 Original CRISPR TCCCTTGGATTTTGTGATGG TGG (reversed) Intronic