ID: 1068539481

View in Genome Browser
Species Human (GRCh38)
Location 10:58274815-58274837
Sequence TTAAAAAAAAAAGTGACCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068539473_1068539481 16 Left 1068539473 10:58274776-58274798 CCTGTCTCCCACCATCACAAAAT No data
Right 1068539481 10:58274815-58274837 TTAAAAAAAAAAGTGACCTGTGG No data
1068539477_1068539481 8 Left 1068539477 10:58274784-58274806 CCACCATCACAAAATCCAAGGGA No data
Right 1068539481 10:58274815-58274837 TTAAAAAAAAAAGTGACCTGTGG No data
1068539479_1068539481 5 Left 1068539479 10:58274787-58274809 CCATCACAAAATCCAAGGGAGGT No data
Right 1068539481 10:58274815-58274837 TTAAAAAAAAAAGTGACCTGTGG No data
1068539475_1068539481 9 Left 1068539475 10:58274783-58274805 CCCACCATCACAAAATCCAAGGG No data
Right 1068539481 10:58274815-58274837 TTAAAAAAAAAAGTGACCTGTGG No data
1068539480_1068539481 -7 Left 1068539480 10:58274799-58274821 CCAAGGGAGGTAAAGCTTAAAAA No data
Right 1068539481 10:58274815-58274837 TTAAAAAAAAAAGTGACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068539481 Original CRISPR TTAAAAAAAAAAGTGACCTG TGG Intronic