ID: 1068539482

View in Genome Browser
Species Human (GRCh38)
Location 10:58274816-58274838
Sequence TAAAAAAAAAAGTGACCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068539480_1068539482 -6 Left 1068539480 10:58274799-58274821 CCAAGGGAGGTAAAGCTTAAAAA No data
Right 1068539482 10:58274816-58274838 TAAAAAAAAAAGTGACCTGTGGG No data
1068539479_1068539482 6 Left 1068539479 10:58274787-58274809 CCATCACAAAATCCAAGGGAGGT No data
Right 1068539482 10:58274816-58274838 TAAAAAAAAAAGTGACCTGTGGG No data
1068539477_1068539482 9 Left 1068539477 10:58274784-58274806 CCACCATCACAAAATCCAAGGGA No data
Right 1068539482 10:58274816-58274838 TAAAAAAAAAAGTGACCTGTGGG No data
1068539475_1068539482 10 Left 1068539475 10:58274783-58274805 CCCACCATCACAAAATCCAAGGG No data
Right 1068539482 10:58274816-58274838 TAAAAAAAAAAGTGACCTGTGGG No data
1068539473_1068539482 17 Left 1068539473 10:58274776-58274798 CCTGTCTCCCACCATCACAAAAT No data
Right 1068539482 10:58274816-58274838 TAAAAAAAAAAGTGACCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068539482 Original CRISPR TAAAAAAAAAAGTGACCTGT GGG Intronic