ID: 1068544506

View in Genome Browser
Species Human (GRCh38)
Location 10:58330845-58330867
Sequence GCTCGCCACCACAGAGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068544506_1068544511 1 Left 1068544506 10:58330845-58330867 CCTTTCCCTCTGTGGTGGCGAGC No data
Right 1068544511 10:58330869-58330891 TCCAAGATGGCCCCTCATCTTGG No data
1068544506_1068544516 16 Left 1068544506 10:58330845-58330867 CCTTTCCCTCTGTGGTGGCGAGC No data
Right 1068544516 10:58330884-58330906 CATCTTGGATTCCCATATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068544506 Original CRISPR GCTCGCCACCACAGAGGGAA AGG (reversed) Intergenic
No off target data available for this crispr