ID: 1068544511

View in Genome Browser
Species Human (GRCh38)
Location 10:58330869-58330891
Sequence TCCAAGATGGCCCCTCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068544503_1068544511 24 Left 1068544503 10:58330822-58330844 CCTTAACACTTGCATTAACTTTT No data
Right 1068544511 10:58330869-58330891 TCCAAGATGGCCCCTCATCTTGG No data
1068544506_1068544511 1 Left 1068544506 10:58330845-58330867 CCTTTCCCTCTGTGGTGGCGAGC No data
Right 1068544511 10:58330869-58330891 TCCAAGATGGCCCCTCATCTTGG No data
1068544508_1068544511 -5 Left 1068544508 10:58330851-58330873 CCTCTGTGGTGGCGAGCCTCCAA No data
Right 1068544511 10:58330869-58330891 TCCAAGATGGCCCCTCATCTTGG No data
1068544501_1068544511 30 Left 1068544501 10:58330816-58330838 CCTTTCCCTTAACACTTGCATTA No data
Right 1068544511 10:58330869-58330891 TCCAAGATGGCCCCTCATCTTGG No data
1068544502_1068544511 25 Left 1068544502 10:58330821-58330843 CCCTTAACACTTGCATTAACTTT No data
Right 1068544511 10:58330869-58330891 TCCAAGATGGCCCCTCATCTTGG No data
1068544507_1068544511 -4 Left 1068544507 10:58330850-58330872 CCCTCTGTGGTGGCGAGCCTCCA No data
Right 1068544511 10:58330869-58330891 TCCAAGATGGCCCCTCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068544511 Original CRISPR TCCAAGATGGCCCCTCATCT TGG Intergenic
No off target data available for this crispr