ID: 1068544516

View in Genome Browser
Species Human (GRCh38)
Location 10:58330884-58330906
Sequence CATCTTGGATTCCCATATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068544507_1068544516 11 Left 1068544507 10:58330850-58330872 CCCTCTGTGGTGGCGAGCCTCCA No data
Right 1068544516 10:58330884-58330906 CATCTTGGATTCCCATATCCTGG No data
1068544510_1068544516 -6 Left 1068544510 10:58330867-58330889 CCTCCAAGATGGCCCCTCATCTT No data
Right 1068544516 10:58330884-58330906 CATCTTGGATTCCCATATCCTGG No data
1068544506_1068544516 16 Left 1068544506 10:58330845-58330867 CCTTTCCCTCTGTGGTGGCGAGC No data
Right 1068544516 10:58330884-58330906 CATCTTGGATTCCCATATCCTGG No data
1068544512_1068544516 -9 Left 1068544512 10:58330870-58330892 CCAAGATGGCCCCTCATCTTGGA No data
Right 1068544516 10:58330884-58330906 CATCTTGGATTCCCATATCCTGG No data
1068544508_1068544516 10 Left 1068544508 10:58330851-58330873 CCTCTGTGGTGGCGAGCCTCCAA No data
Right 1068544516 10:58330884-58330906 CATCTTGGATTCCCATATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068544516 Original CRISPR CATCTTGGATTCCCATATCC TGG Intergenic
No off target data available for this crispr