ID: 1068548351

View in Genome Browser
Species Human (GRCh38)
Location 10:58378260-58378282
Sequence CCAAATCAACAAGTGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068548346_1068548351 -4 Left 1068548346 10:58378241-58378263 CCTGAGCCTTTAGCCACATCCAA No data
Right 1068548351 10:58378260-58378282 CCAAATCAACAAGTGCTGCAGGG No data
1068548347_1068548351 -10 Left 1068548347 10:58378247-58378269 CCTTTAGCCACATCCAAATCAAC No data
Right 1068548351 10:58378260-58378282 CCAAATCAACAAGTGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068548351 Original CRISPR CCAAATCAACAAGTGCTGCA GGG Intergenic
No off target data available for this crispr