ID: 1068556042

View in Genome Browser
Species Human (GRCh38)
Location 10:58460129-58460151
Sequence CAGTGAGTGCCGTGGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068556042_1068556047 -1 Left 1068556042 10:58460129-58460151 CCCATTTCCCACGGCACTCACTG No data
Right 1068556047 10:58460151-58460173 GCTAGAACTCTAAGAGGCAGAGG No data
1068556042_1068556048 7 Left 1068556042 10:58460129-58460151 CCCATTTCCCACGGCACTCACTG No data
Right 1068556048 10:58460159-58460181 TCTAAGAGGCAGAGGATGCAAGG No data
1068556042_1068556046 -7 Left 1068556042 10:58460129-58460151 CCCATTTCCCACGGCACTCACTG No data
Right 1068556046 10:58460145-58460167 CTCACTGCTAGAACTCTAAGAGG No data
1068556042_1068556050 18 Left 1068556042 10:58460129-58460151 CCCATTTCCCACGGCACTCACTG No data
Right 1068556050 10:58460170-58460192 GAGGATGCAAGGGTTCAGTGAGG No data
1068556042_1068556051 19 Left 1068556042 10:58460129-58460151 CCCATTTCCCACGGCACTCACTG No data
Right 1068556051 10:58460171-58460193 AGGATGCAAGGGTTCAGTGAGGG No data
1068556042_1068556049 8 Left 1068556042 10:58460129-58460151 CCCATTTCCCACGGCACTCACTG No data
Right 1068556049 10:58460160-58460182 CTAAGAGGCAGAGGATGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068556042 Original CRISPR CAGTGAGTGCCGTGGGAAAT GGG (reversed) Intergenic
No off target data available for this crispr