ID: 1068561079

View in Genome Browser
Species Human (GRCh38)
Location 10:58514205-58514227
Sequence CCACATCGGTGGCTACAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 65}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068561079 Original CRISPR CCACATCGGTGGCTACAGGT AGG (reversed) Intronic
900483579 1:2910909-2910931 CCACGTCAGAGGCTCCAGGTAGG - Intergenic
900555242 1:3277003-3277025 TCATCTCGGTGGCCACAGGTTGG + Intronic
901725703 1:11240351-11240373 CCACATCGCTGGCCTCAGGGAGG + Exonic
902164808 1:14561519-14561541 GCAGATCAGTGGCTGCAGGTGGG + Intergenic
902919238 1:19656625-19656647 CCACACTGGTGGCTGCTGGTGGG + Intronic
918710714 1:187725650-187725672 CCACAGCTGTGGCTACAGCATGG - Intergenic
919478459 1:198056780-198056802 CCACAGCAGTGGCTGCAGGCAGG + Intergenic
919748962 1:201024774-201024796 CCACATCTGGGGCTGCAGCTGGG - Intergenic
919757020 1:201072637-201072659 CCACATGGAGGGGTACAGGTAGG + Intronic
920761419 1:208786879-208786901 CCACATCGGTGCCTACAAGCTGG - Intergenic
921395063 1:214660064-214660086 ACACATTGGTGGTTACACGTGGG + Intronic
922724071 1:227914487-227914509 CCACATCCATGGCAACAGCTGGG - Intergenic
1064800028 10:19060182-19060204 AAACATCGGTGGATACTGGTGGG - Intronic
1066446779 10:35491128-35491150 CCACTGGGGTGGCCACAGGTTGG - Intronic
1067655616 10:48189276-48189298 CCACATCGCTGGCTCCAGTTAGG - Intronic
1067689213 10:48490623-48490645 CCACTTCGGTGGCCACAGCTAGG + Intronic
1068561079 10:58514205-58514227 CCACATCGGTGGCTACAGGTAGG - Intronic
1071435404 10:85644369-85644391 CCACAGTGGTTGCTACAGGTGGG - Intronic
1072092054 10:92138211-92138233 CCAATTCTGTGGATACAGGTGGG - Intronic
1076765888 10:132632902-132632924 CCACATCGGTGGCTTAGCGTTGG + Intronic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1078104603 11:8350833-8350855 TCACTTCCGTGGCTACAGGGTGG - Intergenic
1084284130 11:68120823-68120845 CCACATCAGTGTCATCAGGTCGG - Exonic
1085126853 11:74007799-74007821 CCACAGTGGTGGGCACAGGTAGG + Intronic
1087304453 11:96472554-96472576 CCAAAGTGGTGGCTGCAGGTGGG - Intronic
1087809943 11:102599859-102599881 CCACAGCACTGGCTACAGATGGG - Intronic
1089588620 11:119525708-119525730 CCACCTCTGTGGCTCCAGCTGGG + Intergenic
1091450223 12:568290-568312 CCACATGCCTGGCTACAGATTGG + Intronic
1106431728 13:29687268-29687290 CCACATCTGAGGCCACAGGATGG + Intergenic
1112699126 13:101984089-101984111 CCACAGCAGTGGCAACAGGAAGG - Intronic
1114819782 14:26004827-26004849 CCACATAGGTGGCTAAAAATTGG - Intergenic
1120990195 14:90368844-90368866 CTAAATAGCTGGCTACAGGTAGG - Intergenic
1121921786 14:97888605-97888627 CCACCTGGGAGGCCACAGGTTGG + Intergenic
1122466693 14:101938588-101938610 CCACTTCGGGGGCTAGAAGTAGG - Intergenic
1124899221 15:33807101-33807123 CAACATCTGTGGCTACAGAGAGG - Intronic
1129220885 15:74131079-74131101 CCACCTCTCTGGCTGCAGGTTGG - Intronic
1132278616 15:100592512-100592534 CCACCTAGATGGCTACAGGATGG - Intronic
1144890030 17:18489262-18489284 CCACATCGGTGGCTTTGGGAGGG - Intronic
1145142186 17:20455055-20455077 CCACATCGGTGGCTTTGGGAGGG + Intronic
1145793727 17:27643847-27643869 CCACATCGGTGGCTTCAGGAGGG - Intronic
1146469182 17:33110770-33110792 GCACAGGGGTGGCAACAGGTAGG + Intronic
1150493142 17:65588037-65588059 CCACATCAGTGGCTACAATAGGG + Intronic
1154943843 18:21141164-21141186 CCACATGGGTGGCTACAGTAGGG + Intergenic
1157785480 18:50478300-50478322 CAACATCTGTGGGTACAGGTAGG - Intergenic
1161275264 19:3412810-3412832 CCACCTCAGTGGCCCCAGGTGGG + Intronic
1161605295 19:5211585-5211607 CTTCATTGATGGCTACAGGTAGG - Exonic
1166077695 19:40423249-40423271 CCACACTGGGGGCTGCAGGTGGG + Exonic
925118682 2:1401125-1401147 CCATATCTGTGCCTGCAGGTTGG + Intronic
926926786 2:17995629-17995651 CCACTTCAGTGGCCACAGGTTGG + Intronic
949024085 2:241757024-241757046 CCACCTCTGTGGTTACAGGAGGG + Intronic
1172628620 20:36363471-36363493 CCACAGCGGTGGCAGCAGGGTGG + Intronic
1174573387 20:51520084-51520106 CCACATCGGCTGGCACAGGTTGG + Intronic
1178346554 21:31833553-31833575 CCACCTCTGTGGCTAGAGTTTGG + Intergenic
1181344709 22:22210625-22210647 CCACATGGGAGGCCTCAGGTAGG - Intergenic
1182079273 22:27517791-27517813 CCCCATGGGTGTTTACAGGTTGG + Intergenic
953566018 3:44032712-44032734 TCACATCTGTGGCTGCAGGCAGG - Intergenic
962984038 3:140518266-140518288 CCACAGAAGTTGCTACAGGTGGG - Intronic
964124168 3:153218535-153218557 TCACATCTGGGGCTACAGCTAGG - Intergenic
966847320 3:184140723-184140745 CCACATTGGTGAGCACAGGTGGG + Exonic
980968492 4:139546774-139546796 CCAAAGCAGTGCCTACAGGTAGG + Intronic
987359285 5:17092258-17092280 CCACATTGGTGGGTCCAGGAGGG + Intronic
988218508 5:28310831-28310853 CCACAGCAGTGGCTGCAGATGGG - Intergenic
993543438 5:89181372-89181394 CCACATCAGAGGCTAGAGGAGGG - Intergenic
1012733897 6:102914734-102914756 CCACAACGGTGGTTCCATGTGGG + Intergenic
1018666567 6:166143751-166143773 GCACGGCAGTGGCTACAGGTTGG - Intergenic
1022071224 7:26916556-26916578 CCACATCTGTAGCTAAAGCTGGG - Intronic
1023009501 7:35913226-35913248 CCACATCAATGGCAACAGGTGGG + Intergenic
1025123171 7:56323379-56323401 CCACATCAACGGCAACAGGTGGG + Intergenic
1044091734 8:88010771-88010793 CCACATGGGGGACTTCAGGTAGG - Intergenic
1047039878 8:120981484-120981506 ACACATCTGTGGCTACTGATTGG + Intergenic
1048042147 8:130741295-130741317 CCACATTGGTGACTAGAGATTGG + Intergenic
1049794440 8:144490132-144490154 CCACAGCGGTGTCCACACGTGGG - Exonic
1062285647 9:135771434-135771456 CCACAAAGGTGGCCACAGGAAGG - Intronic
1062725453 9:138070934-138070956 CCACATCGGGGCCCACAGATCGG + Intronic
1191162710 X:57348492-57348514 CCACATTGGTGGTTCCAGGTGGG - Intronic
1197443781 X:126523598-126523620 CCAAATATGTGTCTACAGGTAGG + Intergenic