ID: 1068564150 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:58552708-58552730 |
| Sequence | GGCTAGATAGTTTCAGAAAC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1068564150_1068564151 | -10 | Left | 1068564150 | 10:58552708-58552730 | CCTGTTTCTGAAACTATCTAGCC | No data | ||
| Right | 1068564151 | 10:58552721-58552743 | CTATCTAGCCAAGTGATCTTAGG | No data | ||||
| 1068564150_1068564153 | 10 | Left | 1068564150 | 10:58552708-58552730 | CCTGTTTCTGAAACTATCTAGCC | No data | ||
| Right | 1068564153 | 10:58552741-58552763 | AGGAAAGTTATAATTTCTCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1068564150 | Original CRISPR | GGCTAGATAGTTTCAGAAAC AGG (reversed) | Intronic | ||