ID: 1068564151

View in Genome Browser
Species Human (GRCh38)
Location 10:58552721-58552743
Sequence CTATCTAGCCAAGTGATCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068564149_1068564151 17 Left 1068564149 10:58552681-58552703 CCAGAAATAAGGAAATTGAGTTA No data
Right 1068564151 10:58552721-58552743 CTATCTAGCCAAGTGATCTTAGG No data
1068564150_1068564151 -10 Left 1068564150 10:58552708-58552730 CCTGTTTCTGAAACTATCTAGCC No data
Right 1068564151 10:58552721-58552743 CTATCTAGCCAAGTGATCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068564151 Original CRISPR CTATCTAGCCAAGTGATCTT AGG Intronic