ID: 1068564153

View in Genome Browser
Species Human (GRCh38)
Location 10:58552741-58552763
Sequence AGGAAAGTTATAATTTCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068564150_1068564153 10 Left 1068564150 10:58552708-58552730 CCTGTTTCTGAAACTATCTAGCC No data
Right 1068564153 10:58552741-58552763 AGGAAAGTTATAATTTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068564153 Original CRISPR AGGAAAGTTATAATTTCTCT AGG Intronic