ID: 1068564839

View in Genome Browser
Species Human (GRCh38)
Location 10:58563127-58563149
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068564833_1068564839 22 Left 1068564833 10:58563082-58563104 CCGTACCACTGGGTTCAGGGTGG 0: 1
1: 0
2: 0
3: 9
4: 121
Right 1068564839 10:58563127-58563149 CTGTAGGCATGGTGAGATAGTGG No data
1068564835_1068564839 17 Left 1068564835 10:58563087-58563109 CCACTGGGTTCAGGGTGGCATCA 0: 1
1: 0
2: 1
3: 9
4: 181
Right 1068564839 10:58563127-58563149 CTGTAGGCATGGTGAGATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr