ID: 1068566234

View in Genome Browser
Species Human (GRCh38)
Location 10:58578789-58578811
Sequence CTGCACACACAGGTGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 342}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068566234_1068566240 0 Left 1068566234 10:58578789-58578811 CCCTCTCCCACCTGTGTGTGCAG 0: 1
1: 0
2: 5
3: 39
4: 342
Right 1068566240 10:58578812-58578834 GAGTTCAACCTCCCTTCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068566234 Original CRISPR CTGCACACACAGGTGGGAGA GGG (reversed) Intronic
900122408 1:1054436-1054458 CTGCACACCCAGGGAGCAGAGGG + Exonic
900147190 1:1163413-1163435 CTGCAGACACAGGCTGGAGCGGG + Intergenic
900618260 1:3575219-3575241 CAGCGCACACAGGTGGGACCCGG + Intronic
900651727 1:3733132-3733154 TTGGACACACAGGAAGGAGAGGG - Exonic
900805046 1:4762215-4762237 CTGCACACACAGCTAAGACATGG - Intronic
902396099 1:16133143-16133165 CTGCCCACACTGGGTGGAGAGGG - Intronic
902892479 1:19454252-19454274 CTGCACTCACAGGTAGGCTAAGG + Intronic
902979469 1:20112821-20112843 CTGCACAGACACGGGGGAGCTGG + Exonic
903169944 1:21546594-21546616 CAGCACACACAGGCTGGAGGTGG - Intronic
903375171 1:22861223-22861245 CTGCTCACACAGGTGGGTCTGGG + Intronic
904073663 1:27823068-27823090 CTATGCAGACAGGTGGGAGAGGG - Exonic
904430353 1:30460228-30460250 CTGCACACCCAGCTGGGAGAAGG + Intergenic
904925832 1:34047531-34047553 ATTCACACACTGGTGGGAAAAGG - Intronic
906492266 1:46278012-46278034 CTACCCACACAGTAGGGAGATGG + Exonic
906819695 1:48916382-48916404 CTGCAGGCACAGGGAGGAGAGGG + Intronic
907240680 1:53079335-53079357 CTGCAGATACAGGTTTGAGAAGG + Intronic
907350262 1:53823860-53823882 ATACACACACAGCAGGGAGATGG - Intronic
907411921 1:54289293-54289315 CTGCACACACATGTGTGTCAAGG + Intronic
907426060 1:54380026-54380048 CTGTACACCCAGGGGTGAGAGGG + Intronic
909014074 1:70364700-70364722 GTGCAAGCACAGGTGGGAAATGG - Intronic
909024695 1:70468495-70468517 CTGCACACACAGTTGCCAGCAGG + Intergenic
910281125 1:85502821-85502843 CTGCAGACAGAGGTGGTAGGAGG - Intronic
912853624 1:113148135-113148157 CTACACAGAAAGGTGGGGGAAGG - Intergenic
913053695 1:115138728-115138750 CTGGACAGACAAGTGGGGGATGG - Intergenic
913120290 1:115734042-115734064 CCGCAAGCACAGGTGAGAGAGGG + Intronic
913225052 1:116691774-116691796 CTGAGCACACAGGTAGGAAAAGG - Intergenic
913298266 1:117343502-117343524 CTTTCCTCACAGGTGGGAGATGG + Intergenic
913616537 1:120565612-120565634 TTGCACAAACAGGTGGGGGCTGG - Intergenic
913674928 1:121131539-121131561 CTGCTAAAACAGGTAGGAGAGGG + Intergenic
914026769 1:143919171-143919193 CTGCTAAAACAGGTAGGAGAGGG + Intergenic
914573740 1:148945299-148945321 TTGCACAAACAGGTGGGGGCTGG + Intronic
914665152 1:149826606-149826628 CTGCTAAAACAGGTAGGAGAGGG + Intergenic
914670613 1:149867215-149867237 CTGCTAAAACAGGTAGGAGAGGG - Intronic
915631054 1:157154569-157154591 CCCCACACACAGCTGGGAGGTGG - Intergenic
915944819 1:160141896-160141918 CTGGGCAGACAGGTGGGAGATGG + Exonic
916183101 1:162105318-162105340 CTGCACACACCTGTAGGAGGTGG + Intronic
916419555 1:164623490-164623512 ATTCCCACACAGGTGGGAGTGGG + Intronic
917036263 1:170750458-170750480 TTGCACAAACAGCAGGGAGAGGG - Intergenic
917567757 1:176230184-176230206 CTGCACACACAGTTGCCAGCAGG + Intergenic
918174554 1:182031436-182031458 ATGGACAGACAGGTGGGCGAGGG + Intergenic
918646623 1:186913860-186913882 CTGCAACCACATGTGGGACAGGG - Intronic
919910482 1:202107642-202107664 GTGGACAAACAGGTGGGAGGAGG + Intergenic
920268988 1:204749062-204749084 CAGCACCCAGAGGTGGGGGAAGG - Intergenic
920334282 1:205234076-205234098 CTGCAATCTCAGGTGGGAGCCGG + Intronic
920414995 1:205793211-205793233 CAGGACACACAGCTGGGAGGAGG + Intronic
920943818 1:210509687-210509709 CAGCACACACAGAGTGGAGAAGG - Intronic
922092885 1:222414279-222414301 CTTCACACAGGGGTGAGAGAAGG - Intergenic
922157946 1:223054499-223054521 CTGAACACAAAGGTGGGTGATGG - Intergenic
922554492 1:226522348-226522370 CAGGACAGAAAGGTGGGAGAAGG - Intergenic
922945442 1:229509891-229509913 TTAGACACCCAGGTGGGAGAAGG - Intergenic
923113362 1:230910929-230910951 CTGCACACAGTGCTGGGAAAAGG + Intronic
923441856 1:234028195-234028217 GTGCAAACAGAGGTGGAAGATGG - Intronic
923766818 1:236900050-236900072 CTGGACATACAGGTGGGAGTTGG - Exonic
1062875672 10:941159-941181 CAGCACCCACAGGTGGGAGTGGG - Intergenic
1063065183 10:2600821-2600843 CAGAACAAACTGGTGGGAGAGGG + Intergenic
1063611194 10:7563291-7563313 CTGCTCCTTCAGGTGGGAGAGGG - Exonic
1064771028 10:18722981-18723003 CTCCACACACAGGTGGGACAAGG + Intergenic
1067452356 10:46390136-46390158 CTGCATACAGAGCTGGGAAATGG - Intronic
1067572736 10:47383872-47383894 CTGAAAAAACAGGGGGGAGAGGG + Intronic
1067584878 10:47469619-47469641 CTGCATACAGAGCTGGGAAATGG + Intronic
1067667667 10:48291907-48291929 CAGCACACACTTGTGGGAAATGG - Intergenic
1067711623 10:48655498-48655520 CTGCAAAGAAAGGTGGGTGAGGG - Intronic
1067787971 10:49264682-49264704 CTGAATACACAGGTGTGATATGG - Intergenic
1068566234 10:58578789-58578811 CTGCACACACAGGTGGGAGAGGG - Intronic
1069874293 10:71552206-71552228 TTTCACACAGAGGTGGAAGAGGG + Intronic
1070335788 10:75454221-75454243 CTACACAGAAAGGTGGGGGAAGG + Intronic
1072807584 10:98434206-98434228 CTGCCCACACAGCTGGGAAAGGG + Intronic
1073206032 10:101769925-101769947 CTGCACCCCCAGGTGGGGCAGGG - Intergenic
1073355018 10:102847168-102847190 AGGCTCACAGAGGTGGGAGATGG + Intergenic
1073440003 10:103546927-103546949 CAGGACACAGAGGTGGGAAATGG - Intronic
1075166220 10:120070607-120070629 CTGCACACGCAGGAGGGAGAGGG - Intergenic
1075214437 10:120519870-120519892 GTCCTCACACAGGTGGGTGATGG - Intronic
1075815193 10:125259736-125259758 CTGCACCCACAGGAGGGGCAGGG + Intergenic
1076775938 10:132698232-132698254 CCGCACGCCCAGCTGGGAGAGGG + Intronic
1077052664 11:574802-574824 GTGCACACACAGGCGGGGGAGGG - Intergenic
1077058192 11:606145-606167 CTCCACCAACAGGTGGGAGGGGG - Intronic
1078617966 11:12882435-12882457 CTACACACACAGGTGGGGATGGG - Intronic
1078914876 11:15769797-15769819 GTGCCCACACACCTGGGAGAGGG + Intergenic
1079081393 11:17415723-17415745 CTGCACAAACAGCTGGGGCAAGG + Intronic
1079349518 11:19680516-19680538 CCGCACACACAGGAGGGATGCGG + Intronic
1080429844 11:32188318-32188340 CTTCTCACACTGGTGGGAGGGGG - Intergenic
1081098610 11:38972073-38972095 CTCCAGATACAGATGGGAGATGG + Intergenic
1081690428 11:45074213-45074235 CTCCACACCCAGGAAGGAGAAGG + Intergenic
1082009684 11:47441734-47441756 CTGCAGAGCCAGGTGGGGGATGG + Intronic
1083161320 11:60855943-60855965 GGGCAGACAGAGGTGGGAGAGGG + Exonic
1084096586 11:66915443-66915465 CTGGAGACACAGCAGGGAGAAGG - Intronic
1084460210 11:69292944-69292966 ATTCTCACTCAGGTGGGAGATGG - Intergenic
1085773400 11:79344247-79344269 TTACTCACACAGGTGGCAGAGGG + Intronic
1088008039 11:104965982-104966004 CTGATTACTCAGGTGGGAGATGG - Intronic
1088153879 11:106781249-106781271 ATTCACGAACAGGTGGGAGATGG - Intronic
1089329590 11:117680322-117680344 CTGCACCCACAGGAGGGTCAGGG - Intronic
1091658393 12:2362734-2362756 CTGCAGCCACAGGAGAGAGAGGG - Intronic
1092679784 12:10966390-10966412 CTTCACACAGAGGTTTGAGATGG + Intronic
1093901394 12:24638198-24638220 GTGCACACTCAGGTTTGAGAAGG + Intergenic
1094648258 12:32348932-32348954 CAGCACACACAGGTAGAAGGTGG - Intronic
1096458666 12:51808866-51808888 TTGCCCACAGAGGTGGGTGAGGG + Exonic
1096487566 12:51994070-51994092 CTGCACGCTGAGCTGGGAGAGGG - Exonic
1096764080 12:53868767-53868789 GTGCACACAGTGGTGGGAGATGG + Intergenic
1096782097 12:53997462-53997484 CTGGACACAAAGGCGGAAGAGGG - Intronic
1096876988 12:54637091-54637113 TGGGAGACACAGGTGGGAGATGG + Intergenic
1098904247 12:76145554-76145576 CTGAACACATAGCTGGGAGATGG - Intergenic
1100401703 12:94236316-94236338 CAGCACACACAGGTGCTACACGG - Intronic
1100681095 12:96921902-96921924 CACCACACCCAGCTGGGAGAGGG + Intronic
1102164580 12:110796181-110796203 CTACACAAATAGGTAGGAGAGGG + Intergenic
1102790768 12:115643486-115643508 CTGCCCACACAGTTGAGATAAGG + Intergenic
1102905210 12:116669389-116669411 CTGCTCACACTGATGGTAGATGG - Intergenic
1102963790 12:117111355-117111377 CTCCACACTCAGGTGGAAGGAGG + Intergenic
1103902617 12:124311313-124311335 AGGAACACACAGGTGGGAGCTGG - Intronic
1104038728 12:125115775-125115797 CTGCACACAGATGTAGGAGTGGG + Intronic
1104197827 12:126558145-126558167 CGGCCCACACAGGTGGGAGCTGG + Intergenic
1104904999 12:132208392-132208414 CTGCACACACAGACGCCAGAAGG - Intronic
1105257219 13:18751737-18751759 CTGCACACAGAGGGGGGTCATGG + Intergenic
1105303343 13:19153679-19153701 CTCCACACACTGGTCTGAGATGG + Intergenic
1106415269 13:29541048-29541070 CTGCAGCCACAGGTGGGAGAAGG + Intronic
1107544023 13:41420322-41420344 CTGCCCACACACTGGGGAGATGG - Intergenic
1113493988 13:110713826-110713848 GCGCACACACCGGCGGGAGAGGG - Intronic
1113731964 13:112648104-112648126 TTCCACCCACAGATGGGAGATGG + Intronic
1116031351 14:39576682-39576704 CCATACACAAAGGTGGGAGATGG - Intergenic
1118037148 14:61880054-61880076 CTGCAGACAGAGGTGGGAAATGG - Intergenic
1118170762 14:63386470-63386492 GTTCGCACACTGGTGGGAGAAGG + Intronic
1118322918 14:64763893-64763915 GTGCACACACACGTGGGGAAGGG + Intronic
1121297126 14:92837361-92837383 GTGCAGACACAGGTGTGAGGGGG - Intronic
1121422322 14:93824505-93824527 CTTCACAGCCAGGAGGGAGACGG - Intergenic
1121519938 14:94579139-94579161 CAGCACACACAGGCTGGAGACGG + Intronic
1121827700 14:97023772-97023794 CTTCACAGACAAGTGGGAGCTGG + Intergenic
1122137545 14:99643658-99643680 CTGCACAGACAGCTGGGAATAGG - Intergenic
1122138893 14:99650389-99650411 GTGGACTCACAGGTGGGGGAGGG + Intronic
1122182329 14:99965066-99965088 CTGCACACACATGTGACCGATGG + Intergenic
1122870273 14:104635236-104635258 CGGCACACACAGGAGGCAAAGGG + Intergenic
1124149297 15:27162776-27162798 CTGCATTCACAGTTGGGATAAGG + Intronic
1124840956 15:33241715-33241737 ATGCACACACCAGTGGGGGAGGG + Intergenic
1125085197 15:35721730-35721752 CTGCAAACACTGTTGGGGGATGG + Intergenic
1125719856 15:41840139-41840161 CTGCCTGCAGAGGTGGGAGAGGG - Exonic
1126340995 15:47641149-47641171 CTGCACATGCAGGTGGGAAGGGG - Intronic
1126920871 15:53522347-53522369 CAGCACACAAAGATGTGAGAGGG + Intronic
1128257973 15:66212309-66212331 CAGCACACAGAGGTGGGACTTGG + Intronic
1129454960 15:75671831-75671853 CTGCTCACACCGCTGGGTGAAGG + Intergenic
1130065693 15:80603319-80603341 CTGGACACACCTGTGGCAGATGG + Intergenic
1130297382 15:82656813-82656835 CAGCACACACAGGTGGAAGCAGG - Intergenic
1130796442 15:87214670-87214692 CTGCACACACGGGTAGGAATAGG + Intergenic
1130854157 15:87826234-87826256 CTGCACACAGAGGTGGAAGGCGG - Intergenic
1131051973 15:89354333-89354355 CTCCACACACAGGTCTGGGAAGG + Intergenic
1131340848 15:91599241-91599263 CTGCAAGTGCAGGTGGGAGATGG + Intergenic
1132724307 16:1332247-1332269 CTGCACAGACAGGTGTGGGGCGG + Intergenic
1132797298 16:1731420-1731442 CTCCCCACAGAGGTGGGACAAGG + Intronic
1133233162 16:4375889-4375911 CTGGCGTCACAGGTGGGAGACGG + Intronic
1136013346 16:27379143-27379165 CTGCACACACAGGCGGAGGATGG - Intergenic
1138341420 16:56291823-56291845 CTGCATCCTCAGGTGGCAGAAGG + Intronic
1139424285 16:66869534-66869556 GTGAACACACAGCTGGGGGAGGG + Intronic
1139800164 16:69515910-69515932 CTCCACAGAAAGGTGGGCGAAGG - Intergenic
1142875720 17:2851201-2851223 CTGCACACACTGGCTGGAAATGG + Intronic
1143171357 17:4932449-4932471 CTGCAGGCAAGGGTGGGAGATGG + Intronic
1144439005 17:15264838-15264860 GTGCACACACAGCTGGCAGGTGG - Intronic
1146259836 17:31414134-31414156 CTGGTCACACAGCTGGGAAATGG + Intronic
1146683287 17:34823959-34823981 CTTCAGACACAAGTGAGAGATGG + Intergenic
1147254580 17:39174381-39174403 CTCCACACCCAGGTGGCACAGGG + Exonic
1147422969 17:40331709-40331731 CTGGACACACAGGTTGGAGGTGG + Intronic
1147425912 17:40345772-40345794 CTGCACACACAGGTGGAGTGGGG - Intronic
1147601861 17:41751662-41751684 CTGCAAAGACAGCTGGGAAATGG - Intergenic
1150227627 17:63532397-63532419 CTGGGCACACAGCGGGGAGAGGG + Intronic
1151498372 17:74473355-74473377 CTCCGCACACAGGTGGGAATGGG - Intronic
1151678547 17:75612379-75612401 CTGCACATACAGGTTGGACATGG + Intergenic
1152451775 17:80386137-80386159 CTCCACACACAGCCGGGAGCCGG - Intronic
1152810346 17:82378836-82378858 CTCCAAACCCAGGTGGGAGGAGG - Intergenic
1154014461 18:10604287-10604309 CTGCACTCTCAGGTGGGGGTGGG - Intergenic
1154191012 18:12231237-12231259 CTGCACTCTCAGGTGGGGGTTGG + Intergenic
1154428877 18:14293286-14293308 CTGCACACAGAGGTGGGTCATGG - Intergenic
1154431154 18:14309631-14309653 CTGCACACAGAGGGGGGTCATGG - Intergenic
1154433830 18:14328936-14328958 CTGCACACAGAGGGGGGTCATGG - Intergenic
1155891899 18:31280471-31280493 CTTCACAGACAGGTTGGATATGG - Intergenic
1156481846 18:37441307-37441329 GTGTACACACACGGGGGAGATGG + Intronic
1156930052 18:42630678-42630700 CTGCACACAGAATTTGGAGAAGG - Intergenic
1160134531 18:76261312-76261334 CTGCACACAGCGGTGGAACAGGG - Intergenic
1160325335 18:77941698-77941720 CACCACACACAGGAGGGTGAGGG - Intergenic
1160342670 18:78102673-78102695 GTGCAAACAGCGGTGGGAGATGG + Intergenic
1162935184 19:13978553-13978575 CTGCAGACAAGGGTGGGGGATGG - Intronic
1163088524 19:15001505-15001527 TTGGACAGAGAGGTGGGAGATGG + Intronic
1163351574 19:16779454-16779476 CTGGACACACAGGTGAGACTTGG + Exonic
1163378053 19:16945748-16945770 ATGCACACACATCTGGGATAAGG - Intronic
1163396944 19:17069465-17069487 CTAGACACACAGGCGGGGGAAGG - Intronic
1163709305 19:18836522-18836544 CTGGACAGAAAGGTGGGAAAGGG + Intronic
1163741806 19:19018878-19018900 CTGTAGTCACAGGTGAGAGAAGG + Intronic
1164449350 19:28346773-28346795 CTGCACACACAGTTTCAAGATGG + Intergenic
1164704654 19:30311311-30311333 CTGCACACAGGGGTGGCAAAAGG - Intronic
1165067648 19:33238444-33238466 CTGCAGACACAGACGGGAGCAGG + Intergenic
1167073916 19:47237353-47237375 CATCACCCACAGGTGGCAGAGGG - Intergenic
1167233259 19:48298166-48298188 CTACATGCCCAGGTGGGAGACGG - Exonic
1168037733 19:53733529-53733551 CAGGACGCATAGGTGGGAGATGG - Intergenic
1168113798 19:54209589-54209611 CTGGACACACAGCAGGGAGATGG + Intronic
924982733 2:238000-238022 CTGACCACACAAGAGGGAGATGG - Intronic
925641113 2:5986661-5986683 CAGCAGACACGGGTGGGAGAGGG - Intergenic
926317274 2:11719998-11720020 CTGCCCACTGGGGTGGGAGAAGG - Intronic
926885485 2:17594664-17594686 CTGCACACACAGGAGGGCAGAGG - Intronic
927690174 2:25202577-25202599 CTGCTCACACAGGTGTGTGGTGG + Intergenic
927974421 2:27327226-27327248 CTGCGCATGCAGGAGGGAGAGGG - Exonic
928091615 2:28378067-28378089 CTGCACACACAGGTGTGCCAGGG + Intergenic
928111651 2:28515322-28515344 CTGCACAGACAGATGGTAGCTGG - Intronic
928131267 2:28652877-28652899 CTGCACATACAGTTGGAAGATGG - Intergenic
928239514 2:29574390-29574412 CAGCACAGACAGGTGGGAAGAGG - Intronic
929225756 2:39510440-39510462 CTGAACACAGAGTTGGGAGGTGG + Intergenic
931457904 2:62426541-62426563 CCACACACACAGCTGGGAGAAGG + Intergenic
931788761 2:65644897-65644919 ATGCACACCCGGGTGGGAGTTGG + Intergenic
932606846 2:73171191-73171213 CTCCACACCCAGGAGGGAGGGGG - Intergenic
932720824 2:74138069-74138091 CTGCACAGAGAGCAGGGAGAAGG - Intronic
933925582 2:87089219-87089241 CTCCACACCCAGGAGGGAGGGGG + Intergenic
934111604 2:88748487-88748509 CTGCACACACTGTTGGTAGAAGG - Intronic
936083545 2:109451575-109451597 CTTCACACTTAGGTGGGTGATGG - Intronic
937957069 2:127427460-127427482 CTGCACACACATGTTTGTGAGGG + Intronic
938291660 2:130153864-130153886 CTCCGCACACTGGTCGGAGATGG + Exonic
938464891 2:131519099-131519121 CTCCGCACACTGGTCGGAGATGG - Intergenic
939770322 2:146308025-146308047 CTGCAAACTCAGGTGAGAGAAGG + Intergenic
940616861 2:156059739-156059761 CTGCTCTCATAGGTGGGAGCAGG + Intergenic
941065949 2:160902988-160903010 CTGCACACTGGGGTGGGAGAGGG + Intergenic
941885368 2:170522154-170522176 CAGAACACACTGGTGAGAGATGG - Intronic
943548786 2:189312661-189312683 CTGAACACACCTGTGGGAGGTGG - Intergenic
948278137 2:236725762-236725784 GGGCACACACAAGAGGGAGAGGG - Intergenic
948542566 2:238701150-238701172 CTTCACCCACAGGTGGCTGAGGG - Intergenic
948815503 2:240508165-240508187 CTGGGCACACAGCAGGGAGAAGG - Intronic
948946568 2:241223558-241223580 CTCCACCCACAGCTGGGAGCAGG + Intronic
1169046382 20:2537305-2537327 CTCCACACACAGGTGAGATGGGG + Exonic
1169698476 20:8418896-8418918 CTGCCTACACAGAGGGGAGAGGG + Intronic
1170416568 20:16148872-16148894 CTCCCCACTTAGGTGGGAGAGGG - Intergenic
1171055289 20:21900653-21900675 CAGCACACACAGGTGAAAGTGGG + Intergenic
1171429961 20:25076832-25076854 TTGCACAAACAGGTGGGGGAGGG - Intronic
1172166612 20:32903407-32903429 GTGGACACACAGAAGGGAGATGG - Intronic
1172304532 20:33871678-33871700 CAGCCCACACAGTTGGCAGAGGG - Intergenic
1172749952 20:37243819-37243841 CTGCAGACTCAGATGGGAGCTGG + Intergenic
1173150975 20:40566181-40566203 GTGCACACAGAGCTGGCAGATGG - Intergenic
1173842714 20:46168594-46168616 CTCCACACACGTGTGGGAGATGG + Intergenic
1174452305 20:50627959-50627981 CAGGGCACACAGCTGGGAGAGGG + Intronic
1175169755 20:57071950-57071972 GTGCACACACAGGCTGGAGGGGG - Intergenic
1175394159 20:58647456-58647478 GTGCACACTCATGTGGAAGAGGG - Intergenic
1175416420 20:58804319-58804341 CTGCCCACACTGGAGGGAGTGGG - Intergenic
1175468348 20:59208245-59208267 CTGGATACAGAGGAGGGAGATGG - Intronic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1176192987 20:63822317-63822339 CAGCACACCCATGGGGGAGACGG + Intronic
1176845894 21:13876139-13876161 CTGCACACAGAGGGGGGGCATGG + Intergenic
1176848627 21:13895682-13895704 CTGCACACAGAGGGGGGGCATGG + Intergenic
1177744902 21:25200060-25200082 CTGCACACACAAAGAGGAGAGGG - Intergenic
1179473124 21:41625521-41625543 CTGCACACAGAGTGGGGACAGGG + Intergenic
1180053455 21:45344544-45344566 CTGGACACACAGCTGGGGGGAGG + Intergenic
1180149082 21:45938569-45938591 CACCACACACAGGTGTGAGCAGG + Intronic
1180792821 22:18586009-18586031 CACCAGGCACAGGTGGGAGAAGG - Intergenic
1180995281 22:19962425-19962447 CTGCAAACACAAGGGGGCGATGG + Intronic
1181111296 22:20604477-20604499 CTCCACACACTGGTCCGAGATGG + Intergenic
1181228915 22:21409310-21409332 CACCAGGCACAGGTGGGAGAAGG + Intergenic
1181249736 22:21525555-21525577 CACCAGGCACAGGTGGGAGAAGG - Intergenic
1181495209 22:23283725-23283747 CTGAACACACAGGAGGGATTGGG + Intronic
1182915234 22:34023339-34023361 CCGCAGACACAGGAGTGAGAAGG + Intergenic
1183734611 22:39636903-39636925 TAACACGCACAGGTGGGAGATGG + Intronic
1184647546 22:45904261-45904283 CTCCACCCACAGGAGGGAGCTGG - Intergenic
1184658274 22:45952923-45952945 CAGCAGACACAGCTGGGAGGCGG - Intronic
1185228559 22:49667682-49667704 CAGCACATGCAGGTGGGAGGAGG + Intergenic
1185228715 22:49668123-49668145 CAGCACATGCAGGTGGGAGGAGG + Intergenic
1185228762 22:49668249-49668271 CAGCACACGCAGGTGGAAGAAGG + Intergenic
949809008 3:7985858-7985880 CTGTACACACAGCTAGTAGAGGG - Intergenic
950492621 3:13315119-13315141 CTGCAAAGGCATGTGGGAGAGGG + Intergenic
950589674 3:13927757-13927779 CTGAACATCCATGTGGGAGAAGG + Intergenic
950884786 3:16353743-16353765 GAGCACGCACAGGTGGGAGGGGG - Intronic
952368921 3:32700775-32700797 CTGCAAACATAGGTAGGTGATGG - Intronic
952426460 3:33179601-33179623 CTACACAGAAAGGTGGGAGAAGG + Intronic
952946604 3:38482133-38482155 ATACACACACAGCTGGGACATGG - Intronic
952946732 3:38482868-38482890 CAACATACACAGGAGGGAGAAGG - Intronic
953206776 3:40838257-40838279 CTGGACACACAGGTGGGGTTTGG + Intergenic
954145537 3:48632625-48632647 CAGTAGACACAGGTGGGACAGGG - Intronic
954680712 3:52344467-52344489 CTGCCCATAGAGATGGGAGATGG - Intronic
954816260 3:53283243-53283265 GTTCACACACAGGTGTGAGATGG - Intergenic
959167142 3:102794566-102794588 CTGGAAACACAGAAGGGAGAAGG - Intergenic
960571533 3:119189394-119189416 TTGCACACACTCTTGGGAGAAGG - Intronic
963609752 3:147452412-147452434 CTGGAGACACAGGTGGTTGAGGG + Intronic
965212457 3:165810406-165810428 CTGCACACACAGGAAGGAAATGG - Intronic
965360776 3:167735412-167735434 CCGGACACACAGGTCGGGGAAGG + Intronic
966396504 3:179509583-179509605 CTGCAAACCCAGGTGGGACAGGG - Intergenic
967765323 3:193272601-193272623 CTACACCCACCAGTGGGAGAAGG + Intronic
968789335 4:2648712-2648734 GTGCACCCACAGATGGCAGAGGG - Intronic
968962342 4:3751981-3752003 CTGGACACAGAGGTGGGAGCAGG + Intergenic
969338131 4:6523600-6523622 CTGCACACACTGCTGGGGGCAGG + Intronic
969411465 4:7031228-7031250 CTGAACAGGCAGGTGGGAGAGGG - Exonic
971293195 4:25363785-25363807 ATGCACACAAAGGTGGTAAAAGG + Intronic
971615573 4:28786567-28786589 CTGCAGACAGAGGTGGAGGAAGG + Intergenic
972496373 4:39638704-39638726 CAGCAAACGCTGGTGGGAGAGGG + Intronic
972737978 4:41864138-41864160 CTGCACAAACCTGGGGGAGAGGG + Intergenic
977761135 4:100738646-100738668 AAGCACACACAGGCAGGAGATGG - Intronic
982397164 4:154925306-154925328 CTGCACACACCTGTAGGAGGTGG + Intergenic
984133434 4:175906735-175906757 CTGCACCCACAGCTCTGAGAAGG - Intronic
985547461 5:517060-517082 ATGCACCCACAGGTGGGTGAAGG - Intronic
985819364 5:2149200-2149222 CTCCCGATACAGGTGGGAGATGG + Intergenic
987450203 5:18074069-18074091 ATGCAGACATAAGTGGGAGACGG - Intergenic
987939859 5:24519981-24520003 GTGAACACACAGGGAGGAGATGG - Intronic
989180165 5:38568548-38568570 CTCCTCACACATGTGGCAGAGGG - Intronic
989647117 5:43646703-43646725 CTGCACACATGGGTAGGACAAGG + Intronic
991596104 5:68307431-68307453 CTGAACACAGAGTTGGGAGGAGG + Intergenic
993011915 5:82492636-82492658 CTTCCCACAGATGTGGGAGAGGG - Intergenic
996342162 5:122451089-122451111 CTGCTCTCTGAGGTGGGAGATGG - Exonic
996485546 5:124029589-124029611 CTGCAGAATCAGGTGGGTGAAGG - Intergenic
996754287 5:126919859-126919881 CTGAACCCACAGTGGGGAGACGG + Intronic
997697224 5:135871438-135871460 CTGCAAAGACAGGGGAGAGAAGG - Intronic
997979205 5:138458656-138458678 CTGCACACTCAGCTGGGGGTAGG + Intergenic
998671457 5:144358780-144358802 CTGCACCCTCAGATGGTAGAAGG + Intronic
998684500 5:144508451-144508473 CCGCACAGAAAGGTGGGGGAAGG + Intergenic
1000127076 5:158256130-158256152 CTGCACACAGCTGTGTGAGAAGG - Intergenic
1001818734 5:174693250-174693272 CTGGAAACACAGGGGGGAGGGGG - Intergenic
1002009275 5:176264147-176264169 CTACTCCCACAGGTGGGAGTTGG + Intronic
1002217448 5:177648136-177648158 CTACTCCCACAGGTGGGAGTTGG - Intergenic
1002622038 5:180494706-180494728 CTGCACTCACAGGGAGGAGGAGG + Exonic
1002790580 6:434768-434790 CTGGACACACAGGTGGAGGGAGG - Intergenic
1003369577 6:5511051-5511073 CTCAAGACACAGGAGGGAGAAGG + Intronic
1003569889 6:7248788-7248810 CTGCAGCCACAGGGAGGAGAAGG + Exonic
1003882952 6:10494792-10494814 ATGCACACACAGGTCTGAGCAGG - Intronic
1006349623 6:33511745-33511767 TTACACACACATCTGGGAGAGGG - Intergenic
1006616097 6:35328078-35328100 CTGTACCCACAGGTGGCAGCTGG - Intergenic
1007556046 6:42767437-42767459 CTGCAAACACAGATGATAGATGG + Intronic
1007902332 6:45423156-45423178 CAGCGGGCACAGGTGGGAGAGGG - Intronic
1012827075 6:104160037-104160059 CTAGAAACACAGGTGGCAGAGGG + Intergenic
1015765209 6:136708933-136708955 CTGCACAGAGAGGACGGAGAGGG - Intronic
1015765648 6:136713170-136713192 CTGCACACAGAGGAAGGAGTGGG - Intronic
1017016215 6:150101634-150101656 CTCCACAAACATGTTGGAGATGG + Intergenic
1017113526 6:150954701-150954723 CTGCACTCCCATTTGGGAGATGG - Intronic
1019212489 6:170417887-170417909 CTGCACACACATGTGGCATGTGG + Intergenic
1019283141 7:210589-210611 ATGCTCCCACAGGTGGGAGGCGG - Intronic
1020136680 7:5591904-5591926 CTGGTCACACAGGAGGGACATGG - Intergenic
1020364985 7:7371552-7371574 CTCCACTCCCAGGTGGGTGAAGG + Intronic
1020649584 7:10857964-10857986 CTGCAATAACAGATGGGAGAAGG + Intergenic
1021486458 7:21173649-21173671 CTGCACACACAGCTTCCAGAGGG + Intergenic
1022041799 7:26588319-26588341 CTGCACACACAGGCGGGGATGGG + Intergenic
1022534291 7:31086165-31086187 CTGCACACACAGGACAAAGACGG - Intronic
1024098551 7:46006026-46006048 CTGTCCTCACAGGTGAGAGAGGG - Intergenic
1027005677 7:74690629-74690651 CTGCACCCAGAGCTGGGAGCTGG - Intronic
1027188478 7:75985137-75985159 CAGCTCACACAGGTGGTCGATGG - Exonic
1029138231 7:98390309-98390331 TTGCAAACAGAGGTAGGAGATGG + Intronic
1030091043 7:105858926-105858948 ATTCACACACATGTGGGGGAGGG + Intronic
1030963242 7:115953523-115953545 CTGCAGACACAGAAGAGAGAAGG + Intronic
1031164803 7:118214985-118215007 CTGAAAACACAGCTGGGACATGG - Intronic
1034545543 7:151786379-151786401 GTGAACACACAGGTGGAAGTGGG + Intronic
1035651218 8:1266821-1266843 CTGCACACACAATGGGGAGAGGG - Intergenic
1035651231 8:1266897-1266919 ATGCACACTCAGTGGGGAGAGGG + Intergenic
1035684398 8:1512902-1512924 GTGCACACACAGATGGCACAGGG - Intronic
1035869786 8:3125310-3125332 CAGGCCACACAGGTGTGAGAGGG + Intronic
1037399211 8:18476731-18476753 CTTCACACACAGGTGGAACCAGG - Intergenic
1037852192 8:22340585-22340607 ATGCAGACACAGACGGGAGAAGG + Intronic
1038432509 8:27511510-27511532 CTGGACACCCAGCTGGAAGATGG + Intronic
1039021500 8:33212039-33212061 ATGAACCCACAGGAGGGAGAAGG - Intergenic
1039032538 8:33325915-33325937 CTGGAAACACAGGTGGGCGCGGG - Intergenic
1039967321 8:42292808-42292830 CAGCTCACACAGCTGTGAGAGGG - Intronic
1040716270 8:50256927-50256949 CTGAACACAGAGGTGGTAGCAGG - Intronic
1043344930 8:79287657-79287679 CTACACGAAGAGGTGGGAGAAGG + Intergenic
1046493626 8:114985382-114985404 CTGCATAAACAAGTGGGCGAAGG - Intergenic
1047000789 8:120570458-120570480 GTTGACACAGAGGTGGGAGATGG - Intronic
1048312588 8:133337096-133337118 CTGGTCACCCAGGTGGGAAATGG - Intergenic
1048951277 8:139498909-139498931 CTACACACACAGATGGGGCAAGG - Intergenic
1049584741 8:143427699-143427721 CTGCGCCTTCAGGTGGGAGACGG + Intronic
1049733734 8:144192390-144192412 CTGCACTCCCAGGTAGGAGGCGG + Exonic
1050278784 9:4028732-4028754 CTGCACATACAAGTGGCAAATGG + Intronic
1051321414 9:15909200-15909222 CAGCATAAACAGGTAGGAGACGG - Intronic
1052991980 9:34523644-34523666 GTCCACACCCAGGTGGCAGAGGG - Intergenic
1053386223 9:37692285-37692307 TTGCACACATAGTTGGGAGAGGG + Intronic
1054456980 9:65437023-65437045 CTTCACAAACAGATTGGAGATGG + Intergenic
1056733717 9:89186382-89186404 CCCCACACACATGTGGGAGTTGG + Intergenic
1057712836 9:97462793-97462815 CTGCACAGATAGGGGGAAGATGG - Intronic
1059497502 9:114721571-114721593 CAGCACACAGAGCAGGGAGAAGG - Intergenic
1060260606 9:122070753-122070775 CTGCACACACAGCCGGATGAAGG - Intronic
1060507983 9:124212728-124212750 CAGGACACACACATGGGAGAAGG - Intergenic
1060892971 9:127200113-127200135 ATGCACACAAATGTGTGAGAGGG - Intronic
1061902515 9:133680350-133680372 CCTCACAGGCAGGTGGGAGATGG - Intronic
1062038599 9:134393787-134393809 AAGCACACACAGGAGGAAGAGGG - Intronic
1062187905 9:135228422-135228444 CTGACCCCACAGCTGGGAGAAGG - Intergenic
1062371175 9:136239594-136239616 CTGCACACACTGCAGGGCGAGGG + Intronic
1062657848 9:137613437-137613459 CTGCAGAGACAGGAGGGAGGTGG - Intronic
1203489574 Un_GL000224v1:90656-90678 CTGCAGATGCAGGTGGGTGAGGG - Intergenic
1203502196 Un_KI270741v1:32544-32566 CTGCAGATGCAGGTGGGTGAGGG - Intergenic
1185873313 X:3682312-3682334 ATGCACACAAAGTGGGGAGAGGG - Intronic
1186199232 X:7139544-7139566 CAGCTGACACAAGTGGGAGAGGG + Intronic
1187495686 X:19793512-19793534 GTGCACTCAGAGGTGGGAGGTGG - Intronic
1187987221 X:24827486-24827508 CTGGATACATAGGTGGGAGCTGG - Intronic
1190051010 X:47148544-47148566 CTGCCCACAGAGGTGGGAATTGG - Intronic
1190263548 X:48814652-48814674 CTGCAGACACAGGAGTGTGATGG - Intronic
1190303063 X:49067521-49067543 CTCCACACACAGGTGGGAGCCGG - Exonic
1191919757 X:66242815-66242837 CTGCTCTGACAGGTGTGAGATGG - Intronic
1191993862 X:67068757-67068779 CTGCACACACCTGTAGGAGGTGG - Intergenic
1192247263 X:69384114-69384136 CAGCACTCACAGCTGGGAGATGG - Intergenic
1193638451 X:83982619-83982641 ATGAACATACAGGTTGGAGAGGG - Intergenic
1194734611 X:97497321-97497343 CAGCACACACAGGCCAGAGATGG - Intronic
1195849800 X:109270972-109270994 CTGCCCACACAGGAGGTAGGTGG + Intergenic
1196938631 X:120753945-120753967 CAGCCCACACAGGTGCGAGGTGG - Intergenic
1199760530 X:150900763-150900785 CTGAACAAACAGGTGGGAGTAGG - Intergenic
1199819534 X:151430982-151431004 GTGAACACACAGGTAGAAGATGG + Intergenic
1199967149 X:152830341-152830363 TTCCACACACAGCTGGGAAAAGG - Intronic