ID: 1068566291

View in Genome Browser
Species Human (GRCh38)
Location 10:58579184-58579206
Sequence CCAGAGGCACAACTGACCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068566291_1068566295 4 Left 1068566291 10:58579184-58579206 CCTTGGGTCAGTTGTGCCTCTGG 0: 1
1: 0
2: 1
3: 13
4: 201
Right 1068566295 10:58579211-58579233 CTTGCGACATTCCTTAGAACTGG No data
1068566291_1068566297 25 Left 1068566291 10:58579184-58579206 CCTTGGGTCAGTTGTGCCTCTGG 0: 1
1: 0
2: 1
3: 13
4: 201
Right 1068566297 10:58579232-58579254 GGCTTGAAACTGAAGCTCAGTGG No data
1068566291_1068566298 26 Left 1068566291 10:58579184-58579206 CCTTGGGTCAGTTGTGCCTCTGG 0: 1
1: 0
2: 1
3: 13
4: 201
Right 1068566298 10:58579233-58579255 GCTTGAAACTGAAGCTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068566291 Original CRISPR CCAGAGGCACAACTGACCCA AGG (reversed) Intronic
900323214 1:2095149-2095171 CCAGAAGCACAGGTGCCCCAGGG - Intronic
901632669 1:10655552-10655574 CCAGAGGCAGGGCTGCCCCATGG - Intronic
903293346 1:22328638-22328660 CCAGAGCCAGAACAGAACCAGGG - Intergenic
904366194 1:30012310-30012332 ACAGAGGAACAACTTGCCCAAGG + Intergenic
905540882 1:38759598-38759620 AGAGAGGAGCAACTGACCCAAGG + Intergenic
911838785 1:102655640-102655662 CCATAGGCAGAGCAGACCCAAGG - Intergenic
911952225 1:104189084-104189106 CCAGAGACATAACTGATCTAAGG - Intergenic
914442040 1:147716357-147716379 CCATAGGCAGAACAGCCCCAAGG + Intergenic
914688430 1:150003515-150003537 CCCAAGGCAGAACTGACCCTTGG + Intronic
915488570 1:156239011-156239033 CCAGAGACAGGAGTGACCCATGG - Intronic
916532806 1:165674245-165674267 CCATAGGCAGAGCTGCCCCAGGG - Intronic
921325667 1:213984627-213984649 CTAGAGGCAAAACTGACTGACGG - Intronic
922777410 1:228221868-228221890 GAAAAGGCACAACTGACCTATGG - Intronic
924708951 1:246518851-246518873 CCAGAGTCAAAGCAGACCCAGGG - Intergenic
1062933165 10:1365787-1365809 ACAGAGGCAGAACTGAACAAAGG + Intronic
1065903575 10:30228842-30228864 CCAGAAGCAAATCTGACCCTGGG + Intergenic
1066759220 10:38738050-38738072 CCAGGGCCAGAACTGAGCCAGGG - Intergenic
1066962404 10:42234720-42234742 CCAGGGCCAGAACTGAGCCAGGG + Intergenic
1068045159 10:51877012-51877034 CCAGAAGCAGATCTGAGCCAAGG - Intronic
1068566291 10:58579184-58579206 CCAGAGGCACAACTGACCCAAGG - Intronic
1069691311 10:70354830-70354852 TCAGAGGCACACGTGACCCTCGG + Intronic
1071389236 10:85154276-85154298 CCAGAGGCACAGCTGGGCCAGGG - Intergenic
1074387524 10:113028402-113028424 CCAGAGGCACTGCTGACCTTTGG + Intronic
1075742096 10:124702120-124702142 CCAGAGGCGCAGCTCACCCTGGG - Intronic
1076077920 10:127551763-127551785 CAAGAGGCAGCTCTGACCCAGGG - Intronic
1076884160 10:133253950-133253972 CGAGACGCACATCTGACCCTGGG - Intergenic
1076990528 11:271158-271180 CCAGAGGCAGAACTGCCTCCTGG - Intergenic
1077481526 11:2817033-2817055 CCAGTGGCACTCCTGACCCCAGG + Intronic
1078104269 11:8348823-8348845 CCAGAGGCACCACTGTTTCAGGG - Intergenic
1080638433 11:34143536-34143558 CCAGATGCACATCAGACCCTGGG - Intronic
1084677417 11:70643981-70644003 CCAGGGTCTCAGCTGACCCAAGG + Intronic
1087129789 11:94658682-94658704 CCAGAGGCAGAAAAGACACAAGG + Intergenic
1088698916 11:112394633-112394655 CCACAGGCACATCTGGCCCCAGG + Intergenic
1089466750 11:118690598-118690620 CCAAAGGCAGCACTGCCCCAGGG - Intergenic
1092100823 12:5882567-5882589 TCAGAGGGACAACTGGCCAAAGG + Intronic
1092251447 12:6900393-6900415 TCACAGGCACAACTGATGCAGGG - Intronic
1093091411 12:14925076-14925098 CCACAGGCAGAACAGCCCCAAGG - Intronic
1093276949 12:17140575-17140597 CCAGAGCCAGACCAGACCCAAGG + Intergenic
1095479223 12:42617681-42617703 CAAGAGGCACAGCTGAGCAAGGG + Intergenic
1096522666 12:52193028-52193050 GCAGAGGCCCACCTGGCCCAGGG + Intergenic
1096759863 12:53832144-53832166 CCAGAGGCACAGCTAATCAATGG - Intergenic
1097668741 12:62512266-62512288 CCAAAGGCTCAACTGAGACAAGG + Intronic
1098085880 12:66842830-66842852 CCAGAGACACACCTTACACATGG - Intergenic
1101620408 12:106381800-106381822 CCATAGGCACAGCAGCCCCAAGG + Intronic
1102890647 12:116556183-116556205 CCATAGGCAGAACAGCCCCAAGG + Intergenic
1103037059 12:117665155-117665177 CCAGGAGCACAACTGCCCCTTGG - Intronic
1105750934 13:23421094-23421116 CCAGAGGAACAACAGGCCCAAGG - Intronic
1106463074 13:29989771-29989793 CCAGAGTCACAGCTGATCCTGGG + Intergenic
1107592163 13:41919914-41919936 GCAGAGGCACAGCTCATCCAAGG - Intronic
1108869986 13:54973019-54973041 CAAGAGGCACAGCTGGGCCAGGG + Intergenic
1110366483 13:74692209-74692231 CCAGAGGATCACCTGAGCCAAGG + Intergenic
1112567843 13:100566505-100566527 CTAGAGGCAGAACTGACCCTGGG + Intronic
1114076580 14:19164565-19164587 CCAGAGGAACACCAGACCCTAGG - Intergenic
1114085584 14:19235003-19235025 CCAGAGGAACACCAGACCCTAGG + Intergenic
1117638174 14:57769256-57769278 CCATGGGCTCAACTCACCCATGG + Intronic
1118364636 14:65084010-65084032 CCAGAGTCAGCACAGACCCATGG + Intronic
1121304848 14:92899634-92899656 CCAGAGGCACAGCTTCCCCTTGG - Intergenic
1122120948 14:99553053-99553075 ACAGAGGCCCAGCTGACCCCAGG - Intronic
1122620604 14:103055903-103055925 CCAGTGACGCAAATGACCCAAGG + Intronic
1122908152 14:104812314-104812336 GCAGAGGCAGAACTCATCCACGG + Intergenic
1125794926 15:42397051-42397073 CCACAGGGACAACTGAGCCCAGG + Intronic
1127030096 15:54851796-54851818 CCAGAGGCACACCTGACAGATGG - Intergenic
1127675723 15:61236771-61236793 CCAAAGGCACAACTGATGAAAGG - Intergenic
1128560859 15:68666938-68666960 CCAGAGCCAAATCTCACCCAAGG - Intronic
1132389982 15:101431506-101431528 CCAGATGCAGAACTGACACTCGG + Intronic
1133337610 16:5016169-5016191 CCAGAGTCATATCTGCCCCAGGG - Exonic
1136723570 16:32341137-32341159 CCAGGGCCAGAACTGAGCCAGGG + Intergenic
1136841901 16:33547182-33547204 CCAGGGCCAGAACTGAGCCAGGG + Intergenic
1137799260 16:51247479-51247501 CCAGTGCCACCACAGACCCAAGG + Intergenic
1138561821 16:57805516-57805538 GCAGAGGCACAGCTGTCTCAGGG + Intronic
1139676647 16:68528538-68528560 CCAGAGGCTCAACTGTGACATGG + Intergenic
1139749880 16:69103313-69103335 CCAGAGGCATCACAGACCCCTGG - Intergenic
1140765451 16:78152728-78152750 CGAGAGGCAAGACTGACCCCAGG - Intronic
1141018436 16:80471989-80472011 AAAGAGGCAAAACTAACCCATGG - Intergenic
1203002862 16_KI270728v1_random:176628-176650 CCAGGGCCAGAACTGAGCCAGGG - Intergenic
1203134467 16_KI270728v1_random:1713034-1713056 CCAGGGCCAGAACTGAGCCAGGG - Intergenic
1203152066 16_KI270728v1_random:1847479-1847501 CCAGGGCCAGAACTGAGCCAGGG + Intergenic
1145779653 17:27553827-27553849 TCAGAGGTAGAACTGAACCAAGG - Intronic
1146585289 17:34076950-34076972 CCAGCTGCAGAACTGGCCCATGG - Intronic
1147284577 17:39391470-39391492 CCAGAGACGTAACTTACCCAAGG + Intronic
1147593031 17:41697451-41697473 CCAGAGGTTCATGTGACCCAGGG - Intergenic
1147637560 17:41973407-41973429 CTTGAGGAACAGCTGACCCAGGG - Intronic
1148157838 17:45433390-45433412 CCACAGGCACAACTGTTCCTTGG - Intronic
1151014849 17:70542403-70542425 CCATAGACACAGCAGACCCAAGG - Intergenic
1151241598 17:72762556-72762578 CCATAGGCAGAGCTGCCCCAAGG - Intronic
1151441390 17:74131519-74131541 TAAGATGGACAACTGACCCAGGG - Intergenic
1152779360 17:82219517-82219539 CCAGAGACACAGCAGGCCCAGGG - Intergenic
1158385220 18:56981906-56981928 ACAGGAGAACAACTGACCCATGG + Intronic
1161013224 19:1970042-1970064 CCAGAGGCTCCAGTGACCCCGGG - Intronic
1163825571 19:19522356-19522378 CCAGAAGCACAAGTGACAAAAGG - Intronic
1166574955 19:43828746-43828768 CCAGAGGAACACCTGAGCCCAGG - Intronic
1168707913 19:58480205-58480227 CCAGAGGCCCAGCCGCCCCAGGG + Exonic
925012798 2:498300-498322 CCATAGGCACCATTGAGCCAGGG - Intergenic
925735269 2:6958310-6958332 CCAGAGACAGAACAGACACACGG + Intronic
927513052 2:23656544-23656566 CAAGAGGCAGAACTGCCCTAAGG - Intronic
930117134 2:47727815-47727837 CCAGAGGCAGAGCAGCCCCAAGG + Intronic
932215427 2:69963082-69963104 CCAGAGGCAGGACTGTCCAAAGG - Intergenic
933642780 2:84782102-84782124 TCAGAGCCACACCTAACCCATGG + Intronic
933948579 2:87308983-87309005 CCAGAGACACCCCTCACCCAAGG - Intergenic
934964109 2:98704942-98704964 CCAGAGGCGCAACTGACATTGGG + Intronic
935523973 2:104143334-104143356 CAAGAGGCAGAAGAGACCCAGGG + Intergenic
935948547 2:108308124-108308146 TCAGCTGGACAACTGACCCAAGG - Intronic
936331620 2:111552613-111552635 CCAGAGACACCCCTCACCCAAGG + Intergenic
936983163 2:118283128-118283150 CCAGAAGGACACCAGACCCAAGG + Intergenic
938968398 2:136408322-136408344 CCAGTGGCCCAAGTGGCCCAGGG + Intergenic
939007954 2:136810848-136810870 CCAGGAGCACCACTGGCCCAAGG - Intronic
942510823 2:176698083-176698105 CCAGTGGCAGAACTGACACTGGG + Intergenic
942648610 2:178143370-178143392 ACAGAAACACAACAGACCCATGG - Intergenic
943293610 2:186108711-186108733 CAAAAGGCACAAATGACCCCTGG - Intergenic
946196049 2:218033598-218033620 CCAAGGGCACAAGAGACCCAGGG + Intergenic
946330194 2:219004573-219004595 CAGGAGGAACAACTGACCAAGGG - Intronic
946862738 2:224015310-224015332 GCAGAGGCACACCTGGGCCAGGG + Intronic
1169023316 20:2346974-2346996 TCAGAGGCACAAATCATCCAAGG - Intergenic
1171432182 20:25090040-25090062 CCAGAGGCTCACATGCCCCATGG + Intergenic
1173746646 20:45442565-45442587 CCATAGGCAGAACAGCCCCAAGG + Intergenic
1174571957 20:51508420-51508442 GCAGTGCCACAACTGGCCCACGG + Intronic
1175505956 20:59484314-59484336 CCACAGGCCCATCTCACCCAGGG - Intergenic
1175608132 20:60328193-60328215 CTGGAGGCACAATTGACCCTTGG + Intergenic
1178090451 21:29157464-29157486 CCAGAGGCTGAAGTGACCCCTGG + Intronic
1178822609 21:35989547-35989569 CCAGGGGCAGAGCTGAGCCAGGG + Intronic
1180292389 22:10858190-10858212 CCAGAGGAACACCAGACCCTAGG - Intergenic
1180495195 22:15887612-15887634 CCAGAGGAACACCAGACCCTAGG - Intergenic
1181293923 22:21819699-21819721 CCCCAGGCTCAAGTGACCCAAGG + Intronic
1182347381 22:29675887-29675909 CCAGAGGCACAAGCTGCCCAGGG + Intronic
1182693045 22:32176693-32176715 GCAGAGGCACAAGGAACCCAAGG - Intergenic
1182712554 22:32331931-32331953 CCAAAGCCACATCTGCCCCAAGG + Intergenic
1182762593 22:32734708-32734730 CCAGAGGCACAAATAAACCCAGG - Intronic
949727624 3:7068217-7068239 CCAGTGGAACAACTGAGCAAAGG + Intronic
949904008 3:8843353-8843375 CCAGATGCTCAGCTGACCCCAGG - Intronic
950160824 3:10759608-10759630 CCTGGGGCACAACAGACACATGG + Intergenic
950997280 3:17516233-17516255 CCAGAGGCACATCAGAGCAAGGG - Intronic
955691480 3:61594696-61594718 CCACTGGCACAACCAACCCAAGG - Intronic
959685319 3:109139814-109139836 CCAGAGGAAAAACAGACCAAAGG - Intergenic
959952360 3:112193889-112193911 CCAGAGCCACAGCTGATCCTAGG + Intronic
960244943 3:115389900-115389922 CAAGTGGTACAACTGAGCCATGG - Intergenic
960333613 3:116391607-116391629 CCAGAGGCAGAGCTGAACCAGGG + Intronic
960582119 3:119289677-119289699 CCAGAGTCACAGCTGATCCTTGG + Intergenic
961133728 3:124491509-124491531 CCAGAGACTCTACTGAGCCATGG + Intronic
961449611 3:126996612-126996634 CCACAGGCAGCCCTGACCCAAGG + Intronic
961696960 3:128712038-128712060 CTAGAGGCACAAAGGCCCCAAGG + Intergenic
962095296 3:132286587-132286609 CCATAGGCACAGCAGCCCCAAGG - Intergenic
962795639 3:138847392-138847414 CCATAGGCAGAACAGCCCCACGG - Intergenic
965055964 3:163716909-163716931 CCAGAGACACAGCTTACCAAAGG + Intergenic
965353616 3:167646352-167646374 CCAGAGGCCAAACTGATCCTTGG - Intronic
967321284 3:188197671-188197693 CCCGAGGCAAAACTCACCCCAGG - Intronic
968088878 3:195887187-195887209 CCGGAGCCTCAACTGACCGACGG + Intronic
969857474 4:10011890-10011912 CCAGAGGTACTAATGACACAAGG + Intronic
969869487 4:10095803-10095825 CCAGAGGCATGACTCACCCGAGG + Intronic
971620437 4:28848772-28848794 CCAGAGGCTCCACTGACCCATGG - Intergenic
973959304 4:56093768-56093790 CCAGAGGCCCTTCTGGCCCAGGG + Intergenic
979040569 4:115787460-115787482 CCAGAGGCACAGGTAACCAAAGG - Intergenic
979556427 4:122052645-122052667 CCAGGAGAACAGCTGACCCAAGG - Intergenic
979800701 4:124905236-124905258 TCAGAAGCAACACTGACCCAAGG - Intergenic
980406942 4:132366018-132366040 CCAAAGTCACAACTGAGACAAGG + Intergenic
982969613 4:161967209-161967231 CCAGAGGCACAGCTGATGAAGGG + Intronic
984353127 4:178621479-178621501 CCAAAGGCCCAACTGAGACAAGG + Intergenic
985717354 5:1470151-1470173 ACAGAGGCACAACTTTACCAAGG - Intronic
986663560 5:10080489-10080511 CCAGGGGCCAAACTGACCCTCGG + Intergenic
987322799 5:16785942-16785964 CCAGTTGAACAACTGAGCCATGG + Intronic
991122844 5:63035315-63035337 CTGGAGGTACAGCTGACCCAGGG - Intergenic
997349533 5:133220768-133220790 CCAGAGGCACCTCAAACCCACGG - Exonic
998949823 5:147382048-147382070 CCTGAGGCACATGTGGCCCATGG + Intronic
1000278309 5:159759880-159759902 CCAGAGGCAAAAGTGATCAAGGG - Intergenic
1002488880 5:179559800-179559822 CCAGTGGCTCTTCTGACCCAAGG + Intronic
1003212792 6:4082189-4082211 CCAGAGCCAGACCAGACCCAAGG - Intronic
1004324507 6:14662596-14662618 CTAGAGGCAACTCTGACCCAGGG - Intergenic
1005273889 6:24195871-24195893 GCAGAATCACAACAGACCCATGG + Intronic
1006398363 6:33801663-33801685 GCAGAGGCTCTACAGACCCAGGG - Intronic
1006683271 6:35812408-35812430 CCCCAGGCACAGCTGCCCCACGG - Intronic
1006856104 6:37134395-37134417 GCAGTGACACAAGTGACCCAAGG - Intergenic
1006911743 6:37567787-37567809 CCAGAGGCACAAAGGAGCCACGG - Intergenic
1007508943 6:42360730-42360752 CCTGAGGATGAACTGACCCAGGG + Intronic
1007846432 6:44761093-44761115 CAAGAGGCATAGCTGACCCAGGG + Intergenic
1007976538 6:46107359-46107381 CGGAAGGCACAACTGAGCCAGGG - Intergenic
1008905388 6:56672158-56672180 CCAGAGGCACAGCCAATCCAGGG + Intronic
1009886795 6:69633042-69633064 CCAGAGACCTAACTAACCCAAGG - Intergenic
1013849638 6:114498358-114498380 CCACAGGCCCACCAGACCCAGGG + Intergenic
1015600905 6:134909501-134909523 CCAGATGGACAACTGAGGCATGG + Intergenic
1017398126 6:154027753-154027775 CCAGAGCCACTACTGGCCCATGG + Intronic
1019982302 7:4630427-4630449 CCAGAGCCACATCTTGCCCATGG + Intergenic
1020920082 7:14252675-14252697 CCAGAGGCATACCTGCCCCACGG - Intronic
1021458620 7:20859573-20859595 ACAGAGGCACAAATGATCTAGGG + Intergenic
1024622809 7:51177224-51177246 CAGGAGGCACAAGTGAGCCAGGG - Intronic
1030063133 7:105639053-105639075 CCAGGGGAACAGCTGACCCAAGG - Intronic
1030073850 7:105720152-105720174 CCAGAGAGGTAACTGACCCAAGG - Intronic
1030099790 7:105935462-105935484 CTTGAGGCACCAGTGACCCATGG + Intronic
1033225631 7:139559989-139560011 CCAGAGGCACAGAAGACCGAGGG + Intergenic
1034294423 7:149959281-149959303 TCAGAGGCACCACAGACCCTTGG + Intergenic
1034681900 7:152935164-152935186 GGAGAGGCACACCTGACCCCCGG + Intergenic
1034811632 7:154137573-154137595 TCAGAGGCACCACAGACCCTTGG - Intronic
1035177892 7:157065380-157065402 CCAGAGGCAGAACAGAAACAGGG + Intergenic
1036809970 8:11861182-11861204 CCAGAGGCCCATCTGTCCCATGG + Intronic
1037309290 8:17537520-17537542 CCAGAGAGACATCTGACTCAGGG - Intronic
1037690957 8:21181217-21181239 CCAGAGATAAAACTTACCCATGG - Intergenic
1042848158 8:73188846-73188868 CATGAGGCAGAACTCACCCAGGG + Intergenic
1045700458 8:104860801-104860823 CCAGAAGCCCAACTTTCCCATGG - Intronic
1048608151 8:135991503-135991525 CTAAAGGCACACCTGGCCCAGGG - Intergenic
1049480414 8:142819898-142819920 CCAGAGGCACGACTCACCGAAGG + Intergenic
1050766514 9:9141270-9141292 CCTGAGGCACTACAGACCCTAGG + Intronic
1052024785 9:23562443-23562465 CCAAAGGCAGAAATGACACAGGG + Intergenic
1052940780 9:34130493-34130515 AAACAGGCACAACTGATCCATGG + Intergenic
1053046879 9:34927227-34927249 CCAGAGTCACAGCTGATCCTAGG + Intergenic
1055765742 9:79661930-79661952 CTAGAGGCAAAACTGAACCCAGG - Intronic
1056763468 9:89430423-89430445 CCAGACGCAAAACCCACCCAGGG + Intronic
1057502571 9:95607322-95607344 ACAGAGGCAAACTTGACCCAGGG - Intergenic
1057870062 9:98709967-98709989 GCAGAGGCACAAGGAACCCAAGG - Intergenic
1062202176 9:135309397-135309419 CCAGAGGCAGAGCTGTCCCCTGG - Intergenic
1062504219 9:136865223-136865245 TCAGACTCACAACTGACCCTCGG + Intronic
1186606963 X:11102241-11102263 CCAGAGGCAGAAGTGACCATAGG - Intergenic
1190214084 X:48468634-48468656 CCAGGGACAGAAATGACCCAGGG + Intronic
1191672466 X:63761076-63761098 CCAAAGCCACAAATCACCCATGG + Intronic
1197621143 X:128750514-128750536 CCAGAAGCACAAATGACCAGAGG + Intergenic
1197728654 X:129792870-129792892 AGGGAGGCACAACTGCCCCAGGG + Intronic
1198643997 X:138786671-138786693 CCAGAGGCAGCAATGACCCAAGG + Intronic
1199546064 X:149008343-149008365 AACTAGGCACAACTGACCCAAGG - Intergenic
1202067942 Y:20960216-20960238 CCAGAGGCACAGGTGCCACAGGG + Intergenic