ID: 1068566293

View in Genome Browser
Species Human (GRCh38)
Location 10:58579200-58579222
Sequence GAATGTCGCAAGGAAGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068566293_1068566297 9 Left 1068566293 10:58579200-58579222 CCTCTGGCTTCCTTGCGACATTC 0: 1
1: 0
2: 0
3: 5
4: 134
Right 1068566297 10:58579232-58579254 GGCTTGAAACTGAAGCTCAGTGG No data
1068566293_1068566299 21 Left 1068566293 10:58579200-58579222 CCTCTGGCTTCCTTGCGACATTC 0: 1
1: 0
2: 0
3: 5
4: 134
Right 1068566299 10:58579244-58579266 AAGCTCAGTGGGTGTCCACAAGG No data
1068566293_1068566300 22 Left 1068566293 10:58579200-58579222 CCTCTGGCTTCCTTGCGACATTC 0: 1
1: 0
2: 0
3: 5
4: 134
Right 1068566300 10:58579245-58579267 AGCTCAGTGGGTGTCCACAAGGG No data
1068566293_1068566298 10 Left 1068566293 10:58579200-58579222 CCTCTGGCTTCCTTGCGACATTC 0: 1
1: 0
2: 0
3: 5
4: 134
Right 1068566298 10:58579233-58579255 GCTTGAAACTGAAGCTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068566293 Original CRISPR GAATGTCGCAAGGAAGCCAG AGG (reversed) Intronic
910881791 1:91928376-91928398 GGAAGCAGCAAGGAAGCCAGTGG + Intergenic
912723437 1:112039116-112039138 GACTTTTGGAAGGAAGCCAGAGG - Intergenic
913445886 1:118950275-118950297 GCCTGTCCCAATGAAGCCAGAGG - Intronic
915938638 1:160104206-160104228 GACTGTCCCGAGGGAGCCAGGGG - Intergenic
920310544 1:205045730-205045752 GAATATGCCAGGGAAGCCAGAGG + Intronic
921527037 1:216230107-216230129 GAGTGTTGCAAGGAGGACAGTGG + Intronic
922157196 1:223049668-223049690 GCATGTCACCTGGAAGCCAGGGG + Intergenic
922962093 1:229656358-229656380 TAATGAGGCCAGGAAGCCAGAGG - Intronic
923619666 1:235568114-235568136 GTATGTTGCAAGGAAGCAACGGG - Intronic
924625897 1:245696232-245696254 GAATGACCCAAGAAAGCAAGAGG - Intronic
1066516368 10:36165249-36165271 GAATGTGGGAGGGAAGACAGAGG - Intergenic
1068566293 10:58579200-58579222 GAATGTCGCAAGGAAGCCAGAGG - Intronic
1075934004 10:126324205-126324227 GAATTTGGCCAGGAGGCCAGGGG + Intronic
1077446448 11:2593243-2593265 GAATGCCCCTAGGAGGCCAGAGG + Intronic
1079290411 11:19183338-19183360 GAATGTAGGAAGGGAGGCAGAGG - Intronic
1082027880 11:47586088-47586110 GAATGTTGCTAGGAAACAAGAGG + Intergenic
1082237702 11:49839288-49839310 GAATCTCGCAAGTATTCCAGAGG - Intergenic
1084463807 11:69310612-69310634 TAATGTGGAAAGGAAGCCTGCGG + Intronic
1086125843 11:83347641-83347663 GAAGGTCACAAGAAAGCTAGAGG - Intergenic
1088146496 11:106686769-106686791 TAATGTAGCATGGAATCCAGAGG - Intronic
1088446286 11:109932366-109932388 GAATTCTGCATGGAAGCCAGAGG - Intergenic
1091081225 11:132670249-132670271 GAATGGCGCAAGTCAGCCACAGG + Intronic
1091616800 12:2055630-2055652 GAAGGGAGCAAGGGAGCCAGCGG + Intronic
1092211179 12:6647331-6647353 GAGTGAGGGAAGGAAGCCAGCGG + Exonic
1094719363 12:33047668-33047690 GAATGGCCCCAGGAAGGCAGAGG + Intergenic
1096101938 12:48974843-48974865 GAAATTCGCAAGGAAGAGAGTGG + Intergenic
1097319027 12:58205112-58205134 GATTGTCCCAAGGAAGGCAAGGG - Intergenic
1097530204 12:60790597-60790619 GAATGTCTCAAAAAAGCCATTGG - Intergenic
1099099324 12:78418359-78418381 GACTGTGGCATAGAAGCCAGAGG + Intergenic
1100736609 12:97541793-97541815 AAATGACCCAAGGAAGCCATTGG + Intergenic
1101836101 12:108296453-108296475 GGATGAGGCTAGGAAGCCAGAGG + Intronic
1105949236 13:25214467-25214489 GAATGTCAGAGAGAAGCCAGTGG - Intergenic
1105979511 13:25504067-25504089 GCATGTTGGAAGGAATCCAGTGG + Intronic
1106041178 13:26095267-26095289 TAATGAGGAAAGGAAGCCAGGGG - Intergenic
1108721325 13:53135807-53135829 TAATGTCCCAAGGAACCCGGTGG - Intergenic
1112285417 13:98099822-98099844 GTATGTTGCAAGGAAGCAATGGG - Intergenic
1114781165 14:25539582-25539604 GGATGAAGCAAGGGAGCCAGAGG - Intergenic
1115673279 14:35640628-35640650 GAATTTAGCAATGAAGCCATTGG - Intronic
1115770993 14:36663701-36663723 GTGTGTGGCAAGGAAACCAGGGG - Intronic
1115807193 14:37064281-37064303 GAATGCCTCAGGGAAGCCAATGG - Intronic
1117068569 14:52034930-52034952 AAATGTTTCAAGCAAGCCAGAGG - Intronic
1118278119 14:64404247-64404269 GAAGGTGGGAAGGAAACCAGTGG - Intronic
1118901212 14:69987428-69987450 AAATGTCTCAAAGGAGCCAGAGG - Intronic
1121406392 14:93721656-93721678 GAGTGTCAGAAGGAAGCCAATGG + Intronic
1121957423 14:98226909-98226931 TAAGGTCCCAAGGAAGTCAGTGG - Intergenic
1122337455 14:101003196-101003218 GACTGTGGAAAGGAAGCTAGGGG - Intergenic
1124501926 15:30236080-30236102 GAATGTCTGCTGGAAGCCAGCGG + Intergenic
1124741639 15:32302572-32302594 GAATGTCTGCTGGAAGCCAGCGG - Intergenic
1127008911 15:54601256-54601278 GGATGCCGCAGGGAATCCAGAGG + Intronic
1127791628 15:62403662-62403684 GATTGTGACATGGAAGCCAGTGG - Intronic
1128444247 15:67742739-67742761 GAATTTTGCAAGGAAAGCAGGGG - Intronic
1128513985 15:68330920-68330942 GAAAGTCACAATGAATCCAGGGG - Intronic
1130964580 15:88687340-88687362 CAGTGTTACAAGGAAGCCAGGGG + Intergenic
1131062168 15:89410886-89410908 GATTGTTTCAAGGAACCCAGGGG - Intergenic
1134150498 16:11800985-11801007 GGATGTCTCAAGCAAGCCTGAGG + Intergenic
1136388244 16:29944069-29944091 GAATGTCTGAAGGAAGCAAAGGG + Intronic
1139933955 16:70553723-70553745 GAGTTTCTCAAGGAAGTCAGAGG - Intronic
1141402873 16:83766091-83766113 TAGTGTCCCAAGGAAGCCTGAGG - Intronic
1142287898 16:89178901-89178923 GAATGACCCCAAGAAGCCAGTGG - Intronic
1143411875 17:6713914-6713936 GGACGTGGCGAGGAAGCCAGGGG - Intergenic
1149036668 17:52141924-52141946 GAAAGTAGAAAGGCAGCCAGTGG + Intronic
1151732516 17:75919894-75919916 CCATGGCGCAAGGAAGGCAGAGG + Intronic
1153616317 18:6937982-6938004 GAATGTCTGAAGGAAGTCAACGG - Intergenic
1158358235 18:56643498-56643520 GAATGTAGCAAGGGAGTCATTGG + Intronic
1159449183 18:68577924-68577946 GTGTGTCCCAAGGAAGCCAAAGG - Intergenic
1163751662 19:19081771-19081793 CAGTGAGGCAAGGAAGCCAGAGG - Intronic
1164523687 19:28998224-28998246 CAATGACACAAGTAAGCCAGAGG + Intergenic
930560493 2:52954564-52954586 CAATGTGGTAAGGAAGGCAGAGG - Intergenic
931580410 2:63765611-63765633 CAATGTTGCATAGAAGCCAGAGG - Intronic
940048077 2:149431037-149431059 GAATGTAGCAAGTAATCCATTGG + Intronic
943475168 2:188345438-188345460 GAATGTACCCAGGAAGACAGGGG + Intronic
944398633 2:199299541-199299563 GAATAATGCAAGGTAGCCAGAGG + Intronic
945108792 2:206343333-206343355 GAATTTCACAAGGAAGTCTGAGG + Intergenic
946231268 2:218292454-218292476 GAACGGCGCAGGCAAGCCAGGGG - Intronic
946233554 2:218307823-218307845 GACTGTGGCAGGGAAGGCAGAGG + Intronic
948892198 2:240912974-240912996 CACTGTCACAAGCAAGCCAGAGG + Intergenic
1169266697 20:4171513-4171535 CAATGCCTCCAGGAAGCCAGAGG - Intronic
1173665472 20:44759935-44759957 GAATGGGGAAAGCAAGCCAGGGG - Intronic
1174753233 20:53132849-53132871 GAATGTCAGAGGTAAGCCAGAGG - Intronic
1175244953 20:57576566-57576588 GAATGTGGCAAGGCAGCCGGAGG + Intergenic
1175860208 20:62146410-62146432 GAATGTGTCAAGGAAGTCACAGG - Intronic
1177233755 21:18359037-18359059 GAATGTGGAAACGAAGCCAAGGG - Intronic
1177559230 21:22729268-22729290 GACTCTCTCAAGAAAGCCAGAGG + Intergenic
1179171310 21:38975188-38975210 GACTGTCCCAGGGAAACCAGAGG + Intergenic
1180899538 22:19360439-19360461 GAATGAAGCAGGGAAGCCAAAGG - Intronic
1181371770 22:22424677-22424699 GAATGTTGGATGGGAGCCAGAGG - Intergenic
1182058839 22:27382322-27382344 GAATGGCCAAAGGAGGCCAGTGG + Intergenic
1183305455 22:37080643-37080665 GAATGTGGAAGGGAAGGCAGAGG - Intronic
1184900028 22:47440337-47440359 GAATATGGCAAGGAAGTTAGAGG - Intergenic
956796705 3:72724499-72724521 CAGTGTCTCAGGGAAGCCAGGGG - Intergenic
961513714 3:127420117-127420139 GGTTGTCGCAGGGAGGCCAGGGG - Intergenic
963338308 3:144002851-144002873 GAATATCGGAAGATAGCCAGAGG + Intronic
963693079 3:148529507-148529529 GAATGTCATAAGGAAGCCCAGGG + Intergenic
966468476 3:180260008-180260030 GAATTTGGCAGTGAAGCCAGTGG - Intergenic
967419895 3:189261174-189261196 GAATGGGGCTAGGAAGACAGGGG + Intronic
968006310 3:195245516-195245538 GAGTGTCCCAAGGAGGCAAGGGG + Intronic
971550326 4:27946913-27946935 GAATGGAGCAAGGTAGCAAGTGG + Intergenic
974103586 4:57443358-57443380 GATGGAAGCAAGGAAGCCAGTGG - Intergenic
977650541 4:99463832-99463854 CAGTGTCGCACAGAAGCCAGTGG - Intergenic
984884315 4:184436663-184436685 GAAGGTGGCAGGCAAGCCAGGGG + Intronic
985910653 5:2877870-2877892 GCATGTTCCAAGGAAGCCCGTGG + Intergenic
989119042 5:37985135-37985157 GAGTGTTGAAAGGAACCCAGAGG - Intergenic
989480424 5:41924998-41925020 GAATGAAGCCAGGAAGTCAGCGG + Intergenic
991197861 5:63957323-63957345 GAATGTTGCAGGGTAGACAGAGG + Intergenic
993642901 5:90427324-90427346 GAATGACCCAAGGATGCCAACGG - Intergenic
994184752 5:96805497-96805519 GAAGGGAGCAAGGAAGTCAGGGG - Intronic
996606865 5:125333590-125333612 GAATGTAGAAATGAAGCCAGTGG + Intergenic
1000165372 5:158643097-158643119 GAATGTCCCAGGGAAATCAGTGG - Intergenic
1001764595 5:174235439-174235461 GAAGGTGGTAATGAAGCCAGGGG + Intronic
1001773618 5:174312879-174312901 GAATGTCTCATGGAAGCGTGTGG + Intergenic
1003520879 6:6857299-6857321 GTATGCCTCAAGGAAGCCAGGGG - Intergenic
1004861883 6:19812625-19812647 AAATGTTCCCAGGAAGCCAGTGG - Intergenic
1007505578 6:42332714-42332736 GACTGTCCCAAAGAAACCAGTGG - Intronic
1011832927 6:91395167-91395189 GTATGGCTAAAGGAAGCCAGAGG + Intergenic
1012230878 6:96760325-96760347 AAATGTCCCAAGGATGTCAGTGG - Intergenic
1013637169 6:112039909-112039931 GCATGTCTCATGGAATCCAGTGG + Intergenic
1016532655 6:145075442-145075464 AAATTTAGAAAGGAAGCCAGAGG + Intergenic
1019207044 6:170370450-170370472 GAAAGGCGAGAGGAAGCCAGGGG - Intronic
1019305340 7:331955-331977 GGAAATCGCAAGGAACCCAGTGG - Intergenic
1019306921 7:339978-340000 GGATGTCACAAGGTAGCCAGAGG - Intergenic
1020670279 7:11098309-11098331 AAAGGTCTCAAGGAAGCCATAGG - Intronic
1022088358 7:27090602-27090624 GGAAGACACAAGGAAGCCAGTGG - Intergenic
1023838685 7:44082982-44083004 GACTGTCACACGGAAGCCGGCGG + Intergenic
1026200648 7:68211698-68211720 GAAAATGGGAAGGAAGCCAGCGG - Intergenic
1027876169 7:83771814-83771836 GAATGTGGCAAAGAATCCAGTGG - Intergenic
1031614732 7:123867103-123867125 GAATGTCTCAGGGAAGACACTGG - Intronic
1040844248 8:51820443-51820465 CAATGAAGCAATGAAGCCAGAGG - Exonic
1047250260 8:123176787-123176809 GATTGTCCCAGGTAAGCCAGTGG + Intergenic
1050560668 9:6831703-6831725 GAATGTCTCATGGAAGGAAGAGG + Intronic
1053006198 9:34606317-34606339 GAGTGGGGCAAGGAAGCTAGAGG - Intergenic
1053264531 9:36701054-36701076 GAATGTGGGAGGGAAGCAAGAGG - Intergenic
1059766387 9:117387692-117387714 GAATGATGCTAGGAAGCCTGTGG - Intronic
1060751744 9:126174130-126174152 GAAGGTGACAGGGAAGCCAGGGG - Intergenic
1061376106 9:130225833-130225855 GCATCTCTCAAGGAAGCCGGCGG - Intronic
1186323679 X:8456289-8456311 GAAGGACGGAAGGAAGACAGGGG - Intergenic
1192277720 X:69650184-69650206 GAATGTCAAAAGGAAGTCATAGG + Intronic
1194995843 X:100590684-100590706 GAATGGAACAAGGAAGCCAATGG - Intronic
1196747637 X:119085836-119085858 GAAAATCCCAAGGATGCCAGAGG + Intronic
1199645914 X:149910387-149910409 GAATTCAGCAATGAAGCCAGTGG - Intergenic
1200049186 X:153419754-153419776 GAGTGTCAGAAGGAATCCAGGGG - Intronic