ID: 1068566294

View in Genome Browser
Species Human (GRCh38)
Location 10:58579210-58579232
Sequence CAGTTCTAAGGAATGTCGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068566294_1068566299 11 Left 1068566294 10:58579210-58579232 CCTTGCGACATTCCTTAGAACTG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1068566299 10:58579244-58579266 AAGCTCAGTGGGTGTCCACAAGG No data
1068566294_1068566297 -1 Left 1068566294 10:58579210-58579232 CCTTGCGACATTCCTTAGAACTG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1068566297 10:58579232-58579254 GGCTTGAAACTGAAGCTCAGTGG No data
1068566294_1068566298 0 Left 1068566294 10:58579210-58579232 CCTTGCGACATTCCTTAGAACTG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1068566298 10:58579233-58579255 GCTTGAAACTGAAGCTCAGTGGG No data
1068566294_1068566300 12 Left 1068566294 10:58579210-58579232 CCTTGCGACATTCCTTAGAACTG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1068566300 10:58579245-58579267 AGCTCAGTGGGTGTCCACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068566294 Original CRISPR CAGTTCTAAGGAATGTCGCA AGG (reversed) Intronic
901426996 1:9188359-9188381 CACTTCTAAGGACTGTGGGAAGG + Intergenic
905754287 1:40495375-40495397 CAGATGTAAGGAATGTGGAAGGG + Exonic
909666458 1:78139338-78139360 TAGTTCTAAGAAATGACTCATGG + Intergenic
911332490 1:96541456-96541478 GAGTTCTATGGAAAGTAGCAGGG - Intergenic
912848632 1:113101690-113101712 CAGTTGTAAGGAATGGAGTAAGG - Intronic
917973198 1:180221712-180221734 CATTTCTAAGGAGTTTCCCAGGG - Intergenic
923083870 1:230686949-230686971 CATTTCTAATGAAAGTCCCAAGG + Exonic
924059768 1:240161157-240161179 CAATTCTAATCAATGTCTCAAGG + Intronic
1066217178 10:33299242-33299264 TAGTTCTAAGGATTGGGGCAGGG - Intronic
1068566294 10:58579210-58579232 CAGTTCTAAGGAATGTCGCAAGG - Intronic
1074077140 10:110139330-110139352 CATGTCTAAGGAATATTGCAGGG - Intergenic
1075530787 10:123227742-123227764 GAGTTCAAAGGAATTTAGCAGGG + Intergenic
1081370042 11:42289546-42289568 CAGTTCTTAGCAATGTCTCTAGG + Intergenic
1081729933 11:45364282-45364304 CTGTTCTCAGGAATATTGCATGG + Intergenic
1096430031 12:51535354-51535376 CAGTTTTAACAAATGTAGCAGGG - Intergenic
1100782185 12:98039183-98039205 CAGTTCTAAAGAGTGTCTCCTGG - Intergenic
1102531164 12:113547518-113547540 CAGTTTTAAGGAAGGTGGAAAGG + Intergenic
1115972811 14:38964818-38964840 CAGTACTGAGGAATGTGGGAGGG + Intergenic
1117167356 14:53050113-53050135 CAGTTCTAAGGAATGAAAGATGG + Intronic
1121337638 14:93086922-93086944 CAGGTCAAAGGAAAGTCCCAAGG + Intronic
1202866552 14_GL000225v1_random:123022-123044 CAGTGCAAAGGTATGTCACAAGG - Intergenic
1124446410 15:29738118-29738140 TTGTTTTAAGGAATGTCACAAGG - Intronic
1127496043 15:59513156-59513178 CAGTTATAAGGAATTTGGGAAGG + Intronic
1135270682 16:21067129-21067151 CAGTTTTCAGGAATGGGGCATGG - Intronic
1137350441 16:47709267-47709289 CAGTTTCAAGAAATGTCTCAGGG - Intergenic
1138812401 16:60166462-60166484 CAGTACTATGGAATGTCTCAAGG - Intergenic
1147503836 17:40993916-40993938 CAGGGCTGAGGAATGTGGCAGGG + Exonic
1147504271 17:40999672-40999694 CAGGGCTGAGGAATGTGGCAGGG + Exonic
1149182358 17:53954502-53954524 CAGATGTAATGAATGTGGCAAGG + Intergenic
1150328178 17:64273531-64273553 CTGTTCTAAGAAATGTAGCCTGG - Intergenic
1157854258 18:51090572-51090594 CAGTTCTAAGAAATGACACTGGG - Intergenic
1160559070 18:79745156-79745178 CAGTTGTAATGACTGTGGCATGG + Intronic
1160681984 19:416079-416101 CAGGTCTAAGGAATGGAGCTGGG + Intergenic
1163424478 19:17233798-17233820 GGGTTCTAAGGAAGCTCGCAGGG + Intronic
1165105475 19:33467282-33467304 CAGAACTAAGGAATGTATCAGGG - Intronic
1167876289 19:52415827-52415849 CAGTTGTAATAAATGTGGCAAGG + Exonic
1167878934 19:52439026-52439048 CAGTTGTAATGAATGTGGCAAGG + Exonic
1167878942 19:52439110-52439132 CAGTTGTAATGAATGTGGCAAGG + Exonic
1167878949 19:52439194-52439216 CAGTTGTAATGAATGTGGCAAGG + Exonic
1167878961 19:52439362-52439384 CAGTTGTAATGAATGTGGCAAGG + Exonic
925020724 2:565579-565601 AAGTTCTAAGGAATTTCCTAGGG + Intergenic
940000681 2:148963989-148964011 CATTTCTAAGGAGATTCGCAAGG - Intronic
1170539713 20:17375496-17375518 TAGTTCTAAGGTATGTGACAGGG - Intronic
1170713345 20:18811298-18811320 CAATTCTAAAGAATGTCGTTGGG + Intronic
1178298897 21:31434831-31434853 CAGTTCTCTGTAATGTCCCACGG + Intronic
1180094991 21:45552321-45552343 CAGCTCTCAGGAGTGTCCCAGGG + Intergenic
954322622 3:49842373-49842395 CAGTTCTTAGGACTGCAGCAGGG - Intronic
956263993 3:67377519-67377541 CAGGCCAAAGGAATGTCACATGG + Intronic
956710661 3:72035960-72035982 CAGTACTAAGGCATGGCCCATGG - Intergenic
957030397 3:75234494-75234516 CAGTTTTAAAGAATGACCCAGGG - Intergenic
957168464 3:76706510-76706532 CAGTACTATAGAATGTCACATGG + Intronic
957712354 3:83877754-83877776 CAGTACTAAGGGATGCCCCAGGG + Intergenic
960132521 3:114072419-114072441 CAGTTCTACAGAATGACACATGG - Intronic
960430843 3:117566815-117566837 CAGTTCTAAGAAATGTCAGCAGG - Intergenic
961704987 3:128777532-128777554 GAGTTCTAAGGAGTTTTGCAAGG - Intronic
973633595 4:52842100-52842122 CAGTTCTCAGGGATTCCGCAAGG - Intergenic
974887503 4:67837913-67837935 CACTCATAAGGAATGTTGCAGGG + Intronic
975725765 4:77290416-77290438 CAGTCCTCAGGATTGTCCCAGGG - Intronic
976148818 4:82071843-82071865 CAGTTCTAAGGTATGGTGCTAGG - Intergenic
983035548 4:162861358-162861380 CATTTCTGGGGAATATCGCATGG - Intergenic
986069326 5:4266506-4266528 CAGTTCCTAGGAAAGGCGCAGGG - Intergenic
991581569 5:68161009-68161031 CAGTTCCAAGGAATTTGGTAAGG + Intergenic
997337091 5:133116022-133116044 CAGTTCTTAGGAAGGACACATGG + Intergenic
997634540 5:135395345-135395367 CAGTTCTAATCAATATTGCATGG - Intronic
1001131612 5:169069115-169069137 CACCTCTAAGGATTGTTGCAAGG - Intronic
1003997918 6:11562514-11562536 CAGTTCTTAAGAATTTGGCAGGG + Intronic
1008317422 6:50062412-50062434 CATTTCTAAGCATTGTAGCATGG + Intergenic
1021281738 7:18728026-18728048 CACTGCTAAAGAATGTTGCAGGG - Intronic
1025622319 7:63185298-63185320 CAGTGCTGGGGAATCTCGCAAGG - Intergenic
1025860485 7:65322263-65322285 CAGTTCTCAAGAATGTCTCTAGG + Intergenic
1038911441 8:31969139-31969161 CAGATGGAAGGAATGTCACATGG - Intronic
1042665420 8:71199352-71199374 CAGTTCCAAGGCATGGTGCAGGG + Exonic
1051448601 9:17169383-17169405 CAATTCAAAGGAATGTACCAAGG - Intronic
1053534765 9:38914406-38914428 CAGTGCTATGGAAGGTTGCAGGG - Intergenic
1054206984 9:62138826-62138848 CAGTGCTATGGAAGGTTGCAGGG - Intergenic
1054631365 9:67449521-67449543 CAGTGCTATGGAAGGTTGCAGGG + Intergenic
1056283560 9:85065349-85065371 AAGATCTTAGGAATGTCCCAAGG - Intergenic
1060443497 9:123664838-123664860 CAGTTCTTATAAATGTCCCATGG + Intronic
1195574656 X:106436468-106436490 CAGTGCCAAGGAATATCTCATGG + Intergenic