ID: 1068566298

View in Genome Browser
Species Human (GRCh38)
Location 10:58579233-58579255
Sequence GCTTGAAACTGAAGCTCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068566291_1068566298 26 Left 1068566291 10:58579184-58579206 CCTTGGGTCAGTTGTGCCTCTGG 0: 1
1: 0
2: 1
3: 13
4: 201
Right 1068566298 10:58579233-58579255 GCTTGAAACTGAAGCTCAGTGGG No data
1068566294_1068566298 0 Left 1068566294 10:58579210-58579232 CCTTGCGACATTCCTTAGAACTG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1068566298 10:58579233-58579255 GCTTGAAACTGAAGCTCAGTGGG No data
1068566293_1068566298 10 Left 1068566293 10:58579200-58579222 CCTCTGGCTTCCTTGCGACATTC 0: 1
1: 0
2: 0
3: 5
4: 134
Right 1068566298 10:58579233-58579255 GCTTGAAACTGAAGCTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068566298 Original CRISPR GCTTGAAACTGAAGCTCAGT GGG Intronic
No off target data available for this crispr