ID: 1068575553

View in Genome Browser
Species Human (GRCh38)
Location 10:58680315-58680337
Sequence GCTGATAAGCAGCTTCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068575548_1068575553 6 Left 1068575548 10:58680286-58680308 CCCGTCATCTCAGCCCAAAAACT 0: 7
1: 242
2: 2416
3: 4991
4: 7651
Right 1068575553 10:58680315-58680337 GCTGATAAGCAGCTTCAGCAAGG No data
1068575550_1068575553 -7 Left 1068575550 10:58680299-58680321 CCCAAAAACTCCTTAAGCTGATA 0: 329
1: 10618
2: 5358
3: 2499
4: 1954
Right 1068575553 10:58680315-58680337 GCTGATAAGCAGCTTCAGCAAGG No data
1068575551_1068575553 -8 Left 1068575551 10:58680300-58680322 CCAAAAACTCCTTAAGCTGATAA 0: 558
1: 10672
2: 5569
3: 2403
4: 1397
Right 1068575553 10:58680315-58680337 GCTGATAAGCAGCTTCAGCAAGG No data
1068575547_1068575553 7 Left 1068575547 10:58680285-58680307 CCCCGTCATCTCAGCCCAAAAAC 0: 2
1: 207
2: 2292
3: 4865
4: 7342
Right 1068575553 10:58680315-58680337 GCTGATAAGCAGCTTCAGCAAGG No data
1068575549_1068575553 5 Left 1068575549 10:58680287-58680309 CCGTCATCTCAGCCCAAAAACTC 0: 148
1: 2176
2: 4902
3: 7461
4: 3610
Right 1068575553 10:58680315-58680337 GCTGATAAGCAGCTTCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068575553 Original CRISPR GCTGATAAGCAGCTTCAGCA AGG Intronic
No off target data available for this crispr