ID: 1068583241

View in Genome Browser
Species Human (GRCh38)
Location 10:58766616-58766638
Sequence ATGGACAAGAGTACCTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068583238_1068583241 -4 Left 1068583238 10:58766597-58766619 CCAATTTTGACAATCACTCATGG 0: 1
1: 0
2: 2
3: 14
4: 153
Right 1068583241 10:58766616-58766638 ATGGACAAGAGTACCTTTGTGGG No data
1068583236_1068583241 9 Left 1068583236 10:58766584-58766606 CCCTGTAGAAGCACCAATTTTGA 0: 1
1: 0
2: 1
3: 17
4: 181
Right 1068583241 10:58766616-58766638 ATGGACAAGAGTACCTTTGTGGG No data
1068583237_1068583241 8 Left 1068583237 10:58766585-58766607 CCTGTAGAAGCACCAATTTTGAC 0: 1
1: 0
2: 3
3: 20
4: 103
Right 1068583241 10:58766616-58766638 ATGGACAAGAGTACCTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068583241 Original CRISPR ATGGACAAGAGTACCTTTGT GGG Intronic
No off target data available for this crispr