ID: 1068586304

View in Genome Browser
Species Human (GRCh38)
Location 10:58803147-58803169
Sequence TCTGCAGCGCGCTCACTCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068586304_1068586307 11 Left 1068586304 10:58803147-58803169 CCAGGGAGTGAGCGCGCTGCAGA 0: 1
1: 0
2: 1
3: 8
4: 110
Right 1068586307 10:58803181-58803203 CTGCCCAGCAAAACTCCGAAAGG 0: 1
1: 0
2: 0
3: 8
4: 80
1068586304_1068586308 12 Left 1068586304 10:58803147-58803169 CCAGGGAGTGAGCGCGCTGCAGA 0: 1
1: 0
2: 1
3: 8
4: 110
Right 1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG 0: 1
1: 0
2: 1
3: 10
4: 87
1068586304_1068586312 29 Left 1068586304 10:58803147-58803169 CCAGGGAGTGAGCGCGCTGCAGA 0: 1
1: 0
2: 1
3: 8
4: 110
Right 1068586312 10:58803199-58803221 AAAGGGCCCACCTTGCTCCACGG 0: 1
1: 0
2: 2
3: 16
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068586304 Original CRISPR TCTGCAGCGCGCTCACTCCC TGG (reversed) Exonic
900474139 1:2868398-2868420 TCTCCTGCACGCTCCCTCCCGGG + Intergenic
900572733 1:3366899-3366921 CGTGCAGCCCCCTCACTCCCCGG - Intronic
906675155 1:47688147-47688169 TCTGCAGCGTTCTCACTCCCTGG - Intergenic
907526885 1:55058915-55058937 CCTGCCGCACGCTCACACCCAGG - Intronic
919741493 1:200983838-200983860 TCTGCAGGGCTCTGACTCCTGGG + Intronic
1065378494 10:25065937-25065959 TCTCCAGCACGCTCCTTCCCTGG + Intergenic
1068180636 10:53513612-53513634 TCTGTTGAGAGCTCACTCCCTGG - Intergenic
1068586304 10:58803147-58803169 TCTGCAGCGCGCTCACTCCCTGG - Exonic
1070814686 10:79315276-79315298 TCTGCACCTCCCTCACACCCTGG - Exonic
1075715820 10:124554691-124554713 TCTGCACCTCGCTTACTCCTGGG + Intronic
1076700127 10:132267164-132267186 ACTGCAGCTGGCTCACTGCCTGG - Intronic
1077476102 11:2791324-2791346 TCCGCACCGCCCTCACGCCCTGG - Intronic
1079374693 11:19881458-19881480 TCTGCTGAGTGCTCATTCCCTGG + Intronic
1083187981 11:61028619-61028641 TGTGCAGGGAGCTCACTCTCGGG - Intergenic
1083859507 11:65412346-65412368 TCTGCTGTGCGCTCCTTCCCAGG + Exonic
1084536237 11:69758836-69758858 TCTGCAGCCCGCTTCCTCTCCGG - Intergenic
1085052757 11:73388258-73388280 TCTGCAGGGAGCTCCATCCCAGG - Intronic
1089100632 11:115959335-115959357 TCTGCTGCGCGGTGTCTCCCCGG - Intergenic
1089254708 11:117188182-117188204 TTGCCAGCGCCCTCACTCCCTGG + Intronic
1090393517 11:126404836-126404858 TCCCCAGCGGGCTCATTCCCAGG - Intronic
1091348385 11:134871899-134871921 TCTGTAGCCCCTTCACTCCCTGG + Intergenic
1093025195 12:14239432-14239454 TCTGCTCCGTGCTCCCTCCCTGG - Intergenic
1096496987 12:52044326-52044348 TCTGCTGAGCCCTCAGTCCCTGG + Intronic
1100493073 12:95099671-95099693 TCTGCTGGGCACTCACTACCTGG + Intronic
1104483910 12:129132876-129132898 TCTGCAGCAAGCTCTCTCCAAGG - Intronic
1104594581 12:130112445-130112467 TCTGCGGGGCTCTCACACCCTGG + Intergenic
1107986394 13:45780220-45780242 TCTGCAGCCCACCCACTTCCTGG + Exonic
1117551870 14:56844838-56844860 ACTGCACCGTCCTCACTCCCCGG + Intergenic
1122324540 14:100874704-100874726 TCTGCAGCTCTCTGACTTCCTGG + Intergenic
1122501945 14:102206693-102206715 TCTGCAGCTCGCTCCATCACTGG - Intronic
1122930897 14:104932693-104932715 TCTGCAGCCCGCTCAGCGCCAGG - Intronic
1123030160 14:105447807-105447829 TCTGCAGGGCCCACACCCCCCGG + Intronic
1127174586 15:56339868-56339890 TCTGGTGAGCGCTCACTTCCTGG - Intronic
1129455596 15:75674812-75674834 TCTGCAGCCAGTTCATTCCCAGG - Exonic
1136270277 16:29144380-29144402 TCTGCAGTGCGCTGACTCCAGGG - Intergenic
1138230278 16:55331377-55331399 GCAGCGGTGCGCTCACTCCCTGG - Intergenic
1141889367 16:86916463-86916485 TCTGCAGGGTGCTCACTTCGAGG + Intergenic
1141921836 16:87140659-87140681 TCTGCAGGGCACTCACACACAGG - Intronic
1142009665 16:87707422-87707444 TGTGCAGCGGCCTCACTCCTGGG - Intronic
1142073867 16:88106214-88106236 TCTGCAGTGCGCTGACTCCAGGG - Intronic
1144656734 17:17042105-17042127 TCTGCAACCCCCTCGCTCCCAGG - Intergenic
1147884840 17:43677553-43677575 TCTGCAGGGTGCTCAGCCCCTGG + Intergenic
1148751060 17:49946213-49946235 TGTGCAGCAGGCTCCCTCCCTGG - Intergenic
1149524870 17:57347630-57347652 TGTTCAGCGAGGTCACTCCCTGG + Intronic
1154207033 18:12346264-12346286 TCTGCAACTCCCTCTCTCCCAGG + Intronic
1155235596 18:23816023-23816045 TCTGAAGCGCGTTTACTCCTGGG + Intronic
1155393996 18:25367334-25367356 TCTGATGCCCACTCACTCCCTGG + Intergenic
1157606629 18:48930069-48930091 TCTCCTGCGAGCTCCCTCCCTGG + Intronic
1158679100 18:59550491-59550513 TCCGCAGTGGGCTGACTCCCTGG + Intronic
1160563417 18:79772651-79772673 GCTGCCGCCCGCTCACTGCCGGG + Intergenic
1161377974 19:3949993-3950015 TCTGCAGCCCCCTCCCTGCCTGG + Intergenic
1161473865 19:4473896-4473918 TCAGAAGCGCTCCCACTCCCTGG - Intronic
1164739398 19:30565311-30565333 TCTGCAACATGCTCTCTCCCCGG - Intronic
1164958319 19:32405722-32405744 TCTCCGGCGCGCCCCCTCCCCGG + Intronic
1165066634 19:33232919-33232941 TCAGGAGCGTGCTCACACCCAGG - Intergenic
1167633439 19:50639656-50639678 GCTGCAGCGCTCCCACTCCCCGG + Intronic
930111191 2:47680187-47680209 TCCACAGCCCACTCACTCCCAGG - Intergenic
931867401 2:66426807-66426829 CCTGGGGCGCGCTGACTCCCTGG - Intergenic
935313460 2:101807799-101807821 TGTGCAGAGCGCTCCTTCCCTGG - Intronic
937021596 2:118661963-118661985 TCTCCTGGGTGCTCACTCCCTGG + Intergenic
941095913 2:161239081-161239103 TGCGCCGCGCGCCCACTCCCCGG + Intergenic
946853545 2:223930834-223930856 CCTGTAGCAAGCTCACTCCCAGG + Intronic
948046271 2:234947730-234947752 TCACCAGGGCTCTCACTCCCTGG + Intergenic
948134804 2:235628480-235628502 TCTGCCTGGAGCTCACTCCCAGG - Intronic
1176063615 20:63182956-63182978 TCTGCAGCTCCTTCATTCCCTGG + Intergenic
1180793978 22:18592893-18592915 CCTACAGCCAGCTCACTCCCAGG - Intergenic
1181227762 22:21402427-21402449 CCTACAGCCAGCTCACTCCCAGG + Intergenic
1181250890 22:21532412-21532434 CCTACAGCCAGCTCACTCCCAGG - Intergenic
1182765115 22:32753033-32753055 TCTCCAGCTGGCTCACTGCCAGG - Intronic
1184987713 22:48146675-48146697 TCTGTAGCTGGCTCACTTCCAGG - Intergenic
1185392736 22:50571374-50571396 GCTGCAGCTGGCTCACTTCCGGG - Exonic
951709837 3:25576503-25576525 TCTGCAGCCCCTTCACTCCTGGG - Intronic
953698462 3:45178314-45178336 GCTCCAGCTCGCACACTCCCTGG - Intergenic
953863042 3:46561577-46561599 ACTGCAGCAGGCTCACTCCCCGG - Intronic
954287533 3:49629618-49629640 TCTGCACCGCAGTCACTCCTGGG - Intronic
955543122 3:59999176-59999198 TATGCAGGGCTCTCTCTCCCAGG - Intronic
958954531 3:100452882-100452904 TCTGCAGCATGCTCACTGACTGG + Intronic
968372666 4:10572-10594 TCTGCGCCGCGCCCACGCCCCGG - Intergenic
968820243 4:2844223-2844245 TCTGCGGCGCCCTCGCTCCCCGG - Intronic
968909436 4:3470047-3470069 ACTGCAGAGCTCTAACTCCCAGG - Intronic
972242900 4:37213300-37213322 TCTGTAGCGCGGTCTCTCTCAGG + Intergenic
972403094 4:38723365-38723387 TTTGCAGACAGCTCACTCCCAGG + Intergenic
972852889 4:43072310-43072332 GCTGCAGCACGCTCTCTCCAGGG + Intergenic
985888707 5:2699638-2699660 TCTTCAGAGTCCTCACTCCCTGG - Intergenic
986238553 5:5935666-5935688 TCCGCAGCTCCCTCACTCTCCGG + Intergenic
986668597 5:10124494-10124516 GCTGCAGCTTGCTCACTGCCGGG - Intergenic
986748035 5:10761154-10761176 TCTCCCGCCCGCTCGCTCCCCGG - Exonic
995044779 5:107633457-107633479 TCTGCATTGCCCTCACTGCCGGG + Intronic
995642048 5:114267974-114267996 TTTGCAGGGAGCTCCCTCCCTGG + Intergenic
996082476 5:119271116-119271138 TCTGCAGTGTGTTCACCCCCAGG - Intronic
998137366 5:139681210-139681232 TGTGCAGCGCGCTCTCGGCCAGG - Exonic
1002474681 5:179457796-179457818 TCAGCAGCGGGGCCACTCCCTGG - Intergenic
1002653543 5:180723337-180723359 TATGCAGCACGCTCACACCCGGG - Intergenic
1003234453 6:4283105-4283127 TCTGCAGGGGTCTCAGTCCCTGG + Intergenic
1003306268 6:4932287-4932309 TCTGCTGAGGGCTCACTTCCTGG + Intronic
1007345714 6:41228250-41228272 TCTGCAGAGCCCGCCCTCCCAGG + Intergenic
1007582260 6:42966542-42966564 ACTGCAGACAGCTCACTCCCAGG - Exonic
1011640143 6:89411154-89411176 CCCGCCGCGCGCTCACTCCCGGG + Intronic
1012895148 6:104939482-104939504 TCTGCATTGATCTCACTCCCAGG + Intergenic
1013032063 6:106343252-106343274 TCTCCAGCATGCTCAGTCCCTGG + Intergenic
1018134656 6:160767509-160767531 GCAGCTGCACGCTCACTCCCAGG + Intergenic
1022100506 7:27166450-27166472 TGTGCGGCGCGCTCGGTCCCCGG + Intronic
1022108400 7:27213245-27213267 TCTGCGGGGCGCCCTCTCCCTGG - Intergenic
1033361513 7:140641295-140641317 TCTGCAGCGCGCTCGGCCCTGGG - Intronic
1034838703 7:154375652-154375674 CCTGCAGAGAGCTCACTTCCTGG - Intronic
1035340526 7:158157788-158157810 GCAGCAGCGCACTCTCTCCCAGG - Intronic
1035366207 7:158350525-158350547 TCTCCAGCTCCCTCACCCCCAGG - Intronic
1038394878 8:27239251-27239273 CCTGCTGCGCGGTGACTCCCGGG - Intronic
1042126037 8:65538053-65538075 TCTGCAGCACCTTCGCTCCCTGG + Intergenic
1047951606 8:129939854-129939876 TCCGCGGCGCCCTCACTTCCTGG - Intronic
1051943029 9:22531355-22531377 TCTACATCTCCCTCACTCCCTGG - Intergenic
1056112200 9:83407026-83407048 TCTGCAGCGAACTCTCTGCCAGG - Intronic
1056967536 9:91177730-91177752 TCTGCAGCAAGATCACACCCAGG - Intergenic
1061450255 9:130663789-130663811 CCTGCACCGCTCTCCCTCCCCGG - Intergenic
1061487912 9:130929590-130929612 TCTGCAGGGCGCTGAGGCCCTGG + Exonic
1062191007 9:135247832-135247854 GCTGCAGCGGGCTGACTCCCAGG + Intergenic
1062267188 9:135692557-135692579 TCTGCACGGCGCTTGCTCCCTGG + Intergenic
1185599357 X:1328180-1328202 TTTGCAGCCCCCTCACTCCTGGG + Intergenic
1187051829 X:15703307-15703329 TGAGCAGAGCCCTCACTCCCAGG + Intronic
1196684315 X:118496903-118496925 TCGAAAGCGCGCTGACTCCCTGG + Intronic