ID: 1068586308

View in Genome Browser
Species Human (GRCh38)
Location 10:58803182-58803204
Sequence TGCCCAGCAAAACTCCGAAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068586304_1068586308 12 Left 1068586304 10:58803147-58803169 CCAGGGAGTGAGCGCGCTGCAGA 0: 1
1: 0
2: 1
3: 8
4: 110
Right 1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG 0: 1
1: 0
2: 1
3: 10
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068586308 Original CRISPR TGCCCAGCAAAACTCCGAAA GGG Exonic
904045313 1:27604819-27604841 TGCTCAGCAGAATTCGGAAAAGG - Intergenic
908573903 1:65439084-65439106 TGCCCAGCAGTACCCTGAAATGG - Intronic
908938331 1:69402186-69402208 TAGCCAGCCAAACTCTGAAAAGG - Intergenic
912669996 1:111616689-111616711 TCCCCAGCAAAACTCAGACCTGG + Intronic
917371759 1:174300987-174301009 GGCCCAGCAAAACCCGGACAGGG - Intronic
922265451 1:223979651-223979673 TGCCCAGCAAAAGCTCCAAACGG + Intergenic
924193409 1:241579382-241579404 TGCCCAGCACAACTCTGACCTGG - Intronic
1063106814 10:2999227-2999249 TGCCTGGGAAAACTCCAAAATGG + Intergenic
1063500667 10:6550819-6550841 TTCCCAGCAAAAGTGCAAAAAGG + Intronic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1068880952 10:62048258-62048280 TGCCCAGCACAACACCCAAAAGG - Intronic
1071361818 10:84854300-84854322 TGCTCAGAGAAACTCCGAACAGG - Intergenic
1071855032 10:89615465-89615487 TGCCAAGAAAAACTTTGAAATGG - Intronic
1074493282 10:113957738-113957760 TGATCAGCAAAACTGGGAAAAGG + Intergenic
1079317285 11:19419484-19419506 TGCCAAGCAAAGCGCAGAAAGGG - Intronic
1081334266 11:41844332-41844354 TGCCCAGCAAAATTCAGCTATGG + Intergenic
1083683035 11:64359958-64359980 TGCCCAGCAAAACCAGGGAAAGG - Intronic
1087102204 11:94376574-94376596 TGCACAGCTAAACTGGGAAAAGG - Intergenic
1091495483 12:968742-968764 TGCCCAGCAAAGATCTGAGAAGG + Intronic
1095121790 12:38427586-38427608 TGCCCAGCAGAACTCAAAACAGG - Intergenic
1095436876 12:42198683-42198705 TGCTCTGTAAAATTCCGAAATGG + Intronic
1096685188 12:53283753-53283775 TGCCTTGCAAATCTCCAAAAGGG + Intronic
1097952434 12:65446818-65446840 TGCCCAGCAGAATTACAAAAAGG + Intronic
1098898119 12:76085045-76085067 TTCCCAGCACAACGCCGAAGGGG - Intergenic
1099881461 12:88471977-88471999 TGCTCAGCAAAACTGCTAATTGG + Intergenic
1105935439 13:25094314-25094336 TGCCCATGAACACACCGAAATGG + Intergenic
1107421119 13:40247735-40247757 TGCCTGACAAAACTCCAAAATGG - Intergenic
1107560405 13:41552492-41552514 TGCCCAGAAAGTCTCCCAAAAGG - Intergenic
1108408035 13:50124397-50124419 TGCCCACTCAAACTGCGAAAGGG + Intronic
1112579540 13:100666427-100666449 TGCTCAGCAGAACCACGAAATGG + Intronic
1120058669 14:79955530-79955552 TGCCTTGCAAAACTCCTGAAGGG + Intergenic
1120472083 14:84938418-84938440 TACCCAGCAATATTCCCAAATGG - Intergenic
1127300232 15:57645753-57645775 TGGCCAACAAGACTCCCAAAGGG - Intronic
1132275693 15:100561645-100561667 TAACCAGAAAAACTCAGAAATGG + Intronic
1135063118 16:19287618-19287640 TGCCCAGCAAAAGTGGGAAGGGG + Intronic
1136678396 16:31937362-31937384 TGCCCTGCAAAAATGCTAAAAGG + Intergenic
1137611864 16:49823598-49823620 TGCTCTGCAACATTCCGAAAGGG + Intronic
1141256800 16:82409816-82409838 TGTCCAGCAAGACTCAGTAAGGG - Intergenic
1146991549 17:37278063-37278085 TGCACAGCAAAACTACGTAAAGG + Intronic
1150724027 17:67636969-67636991 TGCCCAGGAAAACTCAGAAAGGG - Intronic
1151837004 17:76588318-76588340 TTCCCAGCAAAACTCTGACCTGG + Intergenic
1152496664 17:80677628-80677650 TGCCCAGCAAACGCCTGAAAAGG - Intronic
1155103174 18:22634189-22634211 ACCCCAGCAACACTCAGAAAAGG - Intergenic
1156838754 18:41586541-41586563 TGCCCAGCAAATCACTGAAAAGG + Intergenic
1160139312 18:76306793-76306815 TGCCTAGCAAAGGTCGGAAAGGG - Intergenic
1160621049 18:80170887-80170909 TCCCCAGCAAAACTGGGGAAAGG - Exonic
927626196 2:24721585-24721607 TGCCCAGGGAATCTCCCAAAGGG - Intronic
931874300 2:66495636-66495658 TGCCATGCAAAACTGGGAAAGGG - Intronic
936084543 2:109457767-109457789 TGCCCAGAAAAACTCAGTGATGG + Intronic
938217030 2:129526726-129526748 AGCCCAGCAATACTCCCAATGGG + Intergenic
938420950 2:131146277-131146299 TGCCCAACAAAAGCCCAAAAAGG - Intronic
1182476643 22:30580164-30580186 TCCCCACCAAAACTCCTACAGGG + Exonic
952008076 3:28865614-28865636 TGCCCAGCAAAAGAAAGAAAGGG - Intergenic
953564100 3:44016376-44016398 TGCCCACCTAAAATCAGAAAAGG + Intergenic
958541442 3:95480103-95480125 TGCTTAGCCAAACTCCCAAAGGG + Intergenic
962748030 3:138412003-138412025 TCCCCAGCAAAACTCAGGAATGG - Intergenic
963062519 3:141235904-141235926 TCCCCAGCCAAAGTCCAAAAAGG - Intronic
970225829 4:13855796-13855818 TGCACTTCAAAACTCCAAAATGG - Intergenic
971305987 4:25482186-25482208 TGCCCAAAAAAAATCCGGAAAGG + Intergenic
975365058 4:73519501-73519523 TGCCCACCAGAACTGCTAAAAGG - Intergenic
975827507 4:78335224-78335246 TGCCCAGCAATCCTCAGAACTGG - Intronic
978167744 4:105629225-105629247 TGCTCAGCAAAGCTCTGAATTGG + Intronic
978592049 4:110334796-110334818 TACCCAGGAAAACTCTGAAAAGG + Intergenic
981417924 4:144514915-144514937 TTCTCAGCAAAATTCCAAAATGG - Intergenic
981451145 4:144899271-144899293 TGCATAGCAAAACCCCTAAAAGG - Intergenic
981765075 4:148239817-148239839 TGTCCACAAAAACTTCGAAAAGG - Intronic
984321403 4:178201685-178201707 TACCCAGCAAAATGCTGAAAGGG + Intergenic
986982543 5:13465911-13465933 TGCTCAGGAAACCTCAGAAAAGG + Intergenic
989373119 5:40730796-40730818 TGCTCAGAAAAACTTAGAAATGG + Intronic
992867668 5:80973906-80973928 TGACCAGTAATAATCCGAAAAGG + Intronic
997648364 5:135496798-135496820 TGCCCAGGAAGATTCCTAAATGG - Intergenic
998562778 5:143186752-143186774 TGCACAGCAAAGCTCCCCAATGG - Intronic
1008974337 6:57407205-57407227 TGCCCCGCCAAAATCCAAAAAGG - Intronic
1009918064 6:70021179-70021201 TTCCTAGCAAAACTCCGCAATGG - Intronic
1013190444 6:107800559-107800581 TTCTCAGCAAAATTCAGAAAGGG + Intronic
1014252930 6:119133351-119133373 TCCCTAGGAAGACTCCGAAATGG + Intronic
1016974989 6:149798771-149798793 TGCACTGCAAAACTCTGAAAAGG + Intronic
1018973135 6:168542900-168542922 TGCCCAGTAAAACTCCTCAGGGG - Intronic
1021504432 7:21365782-21365804 TGCACAGCATAACTAGGAAAAGG + Intergenic
1023178237 7:37454429-37454451 TACCCAGCAAAACTCGAAACAGG - Intergenic
1023491273 7:40744733-40744755 TGCTCAGCAAAACTCCTTAAGGG - Intronic
1024628581 7:51229496-51229518 TGCCCTGGAAAACTCCAAGAAGG - Intronic
1026166945 7:67918607-67918629 TGCCCATGAAAACCCAGAAATGG - Intergenic
1032225917 7:130031716-130031738 TGCCCAGCAAAGACCTGAAAAGG + Intronic
1036393768 8:8349002-8349024 TGCCCAGCAAAACTTGCAAAAGG + Intronic
1043378564 8:79678080-79678102 TGCTCAGCAAAACCTGGAAAGGG - Intergenic
1045043741 8:98254060-98254082 TAGCCAGCAAAACTCCAAAAAGG + Exonic
1045066865 8:98455686-98455708 TGCCCAGGTAAATTCCCAAAAGG - Exonic
1050074616 9:1850481-1850503 TGTCCAGAAAAACACCAAAATGG - Intergenic
1051246704 9:15119057-15119079 AGCCCAGGAAAACTCCTAATAGG + Intergenic
1052811580 9:33065621-33065643 TACCTTGCAAAACTCCAAAAAGG + Intronic
1057300413 9:93875997-93876019 TGCCCTGCAAAAGTACAAAAAGG + Intergenic
1058719883 9:107754210-107754232 TGCCAAGCAAAAGGCGGAAAAGG - Intergenic
1058817378 9:108696998-108697020 TGCTCAGCAAAACACATAAACGG - Intergenic
1058845043 9:108949155-108949177 TGCCCAGGAAAACTGCTACAAGG + Intronic
1187395737 X:18917589-18917611 TACCCAGCCAAACTCTCAAATGG + Intronic
1188440073 X:30207991-30208013 TGCACTGGAAAACTCCAAAAGGG - Intergenic
1196352920 X:114754251-114754273 TTCCTACCAAAACTCCAAAAAGG + Intronic
1197450541 X:126609357-126609379 TGTAAAGCAAAACTCAGAAATGG + Intergenic