ID: 1068586528

View in Genome Browser
Species Human (GRCh38)
Location 10:58805902-58805924
Sequence GATGTAGTCAAGTGTATGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068586528_1068586529 2 Left 1068586528 10:58805902-58805924 CCTCACATACACTTGACTACATC 0: 1
1: 0
2: 2
3: 12
4: 157
Right 1068586529 10:58805927-58805949 AGTTACTCATTCAGTTTTAATGG No data
1068586528_1068586530 15 Left 1068586528 10:58805902-58805924 CCTCACATACACTTGACTACATC 0: 1
1: 0
2: 2
3: 12
4: 157
Right 1068586530 10:58805940-58805962 GTTTTAATGGAATGAATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068586528 Original CRISPR GATGTAGTCAAGTGTATGTG AGG (reversed) Intronic
901326636 1:8370169-8370191 GTTGTAGTCCAGTGAATGTGGGG - Intronic
909076971 1:71060857-71060879 GTTGTACTTAAGTGTCTGTGGGG - Intergenic
909700455 1:78515491-78515513 AGTGTAGTCAAATGTATATGTGG + Intronic
911575946 1:99578263-99578285 AGTGAAGTCAAATGTATGTGGGG + Intergenic
914405792 1:147370997-147371019 GATGTAGTCAAGAGGATGGCAGG - Intergenic
917522488 1:175759719-175759741 GATGTAGTCAAGTCAAGATGAGG - Intergenic
919318210 1:196001133-196001155 GATGTAAGAAAGAGTATGTGTGG + Intergenic
921868305 1:220109714-220109736 GATGTAATCAAGTTTAGATGAGG - Intronic
922174932 1:223189613-223189635 GATGGGGTCTAGTGCATGTGGGG + Intergenic
1066645448 10:37603013-37603035 TATGTAGTTAAGTGTTTTTGTGG + Intergenic
1067733132 10:48828227-48828249 GATGTAGCCAGTTGTAAGTGGGG - Intronic
1068586528 10:58805902-58805924 GATGTAGTCAAGTGTATGTGAGG - Intronic
1069261844 10:66408061-66408083 GATGACTTCAAGTGTATGTGAGG - Intronic
1069374792 10:67782894-67782916 GATGTAATCAAGTGAAGATGAGG - Intergenic
1069603404 10:69724397-69724419 GAGCCAGCCAAGTGTATGTGGGG + Intergenic
1073078164 10:100837504-100837526 GAGTTAGTCAAGTGAACGTGGGG - Intergenic
1075421034 10:122300852-122300874 GGTTTACTCATGTGTATGTGTGG + Intronic
1076194210 10:128503845-128503867 GATGTAGTCAAGTTAAGATGAGG - Intergenic
1082868231 11:57919224-57919246 GATTTAATCAAGTTAATGTGAGG + Intergenic
1083037412 11:59652378-59652400 AATATAGACAAGTGTATATGTGG - Intronic
1084432804 11:69120948-69120970 CATGTGGGCAAGTATATGTGTGG - Intergenic
1084434266 11:69129699-69129721 GATGTAGTCAAGTGAAGAGGGGG + Intergenic
1084502956 11:69545695-69545717 GATGTAATCAAGTGAAGATGAGG + Intergenic
1086429777 11:86725481-86725503 GAGGTAATCAAGTTAATGTGAGG + Intergenic
1086927645 11:92657457-92657479 GAGGTAGCCAAGTTTATGTGAGG + Intronic
1088591087 11:111403953-111403975 GATATATGAAAGTGTATGTGAGG - Intronic
1091312329 11:134583545-134583567 GATGTAATCAAGTGACTATGTGG + Intergenic
1092051105 12:5470784-5470806 TATGAAGTCAAATGCATGTGTGG + Intronic
1092213550 12:6664336-6664358 GAAGCAGTCAAGGGTATGAGAGG + Intergenic
1093873874 12:24326364-24326386 GATGTAGTCAGTTCTATATGAGG - Intergenic
1093964790 12:25312702-25312724 GAGGTAGGGAAGAGTATGTGTGG + Intergenic
1095345039 12:41140144-41140166 GATGTAGTAAAGAGTGTTTGGGG + Intergenic
1103124701 12:118411334-118411356 GTTGTAGTCAAGCGAATGTAAGG - Intronic
1104167395 12:126246746-126246768 GATGTCTTCAAGTGTAGTTGTGG - Intergenic
1106740652 13:32637505-32637527 TAAGTAGACAATTGTATGTGCGG + Intronic
1107783467 13:43930061-43930083 GATGTAGTCAAGTTAAGATGAGG + Intergenic
1108450364 13:50556534-50556556 TATGTAGTCAAGTTTATGACCGG + Intronic
1109623872 13:64948335-64948357 CAGGTAGTCAAGTGTTGGTGAGG - Intergenic
1110094906 13:71505535-71505557 TATGTAACTAAGTGTATGTGTGG - Intronic
1110662142 13:78069062-78069084 GATGTGGTCATGTGAAAGTGTGG + Intergenic
1111357550 13:87128408-87128430 GATATAGTAAAGGGTATGTTTGG + Intergenic
1111668691 13:91301541-91301563 TATGTAGACATGTGGATGTGGGG - Intergenic
1112704133 13:102047268-102047290 GATGTATGTATGTGTATGTGTGG - Intronic
1115759169 14:36560592-36560614 GATGAAGACAAGTCTCTGTGAGG + Intergenic
1118987547 14:70769840-70769862 GATGTAGTCAAGTTAAGATGAGG - Intronic
1120699192 14:87679358-87679380 GATGCCGACAAGTGTATTTGTGG - Intergenic
1127295931 15:57608437-57608459 TATGGAGTCAAGGGTTTGTGGGG + Intronic
1133903063 16:9995300-9995322 GATGTGGTCAAGAGAATCTGGGG + Intronic
1135286072 16:21194245-21194267 TATGTAATCAAGTGCATATGTGG - Intergenic
1137976411 16:53036023-53036045 GATGTAGCCAAGTTAATATGTGG - Intergenic
1141182631 16:81764751-81764773 GATGTAATCAAGTTAATATGTGG + Intronic
1141896845 16:86963789-86963811 GATGTAGTCAAGTTAAGATGAGG - Intergenic
1147310558 17:39593630-39593652 GATGCAGTCAAGTGCATGTGTGG + Intergenic
1147569068 17:41556531-41556553 GAGGCAGTCAAGCGTGTGTGGGG - Intergenic
1153115951 18:1656390-1656412 GATTTAGTCATGAGTATGTGGGG + Intergenic
1153536792 18:6110434-6110456 CATGTATACATGTGTATGTGGGG + Intronic
1153713815 18:7825486-7825508 GATATAGCCAGGTGTTTGTGAGG + Intronic
1155361605 18:25008652-25008674 GATGTATTCATGTTTGTGTGTGG + Intergenic
1155844614 18:30690016-30690038 GAAGTAGTCAAGTTAAGGTGAGG - Intergenic
1156995672 18:43464244-43464266 AATGCAGTCCAGTGTATGTATGG - Intergenic
1157210114 18:45735093-45735115 GGAGGAGTCAAGTGTATGTGGGG - Intronic
1158425886 18:57339291-57339313 GATGTAGTCAAGTTAAGATGAGG - Intergenic
1159508736 18:69368355-69368377 GAGGTAGTGAATTTTATGTGTGG - Intergenic
1159872247 18:73771521-73771543 TATGTGGTCCAGTGTGTGTGAGG - Intergenic
1161427915 19:4214539-4214561 GTTTTAGTCTGGTGTATGTGTGG - Intronic
1163571792 19:18086698-18086720 GGTGGAGGCACGTGTATGTGTGG - Intronic
1165761843 19:38326192-38326214 GATGAAGCCATGTGTAGGTGTGG + Intronic
1168345769 19:55649574-55649596 GATGGAGGCAGGTGTGTGTGGGG + Exonic
926264761 2:11305418-11305440 GATGTAGATAAATGTCTGTGTGG + Intronic
926845516 2:17133462-17133484 GAGGGAGTCAAGTGCATGTGCGG - Intergenic
927412897 2:22846789-22846811 TATGAAGCCAAGTGTATTTGGGG - Intergenic
929471041 2:42192956-42192978 GAGGTAGTATAGTGTATGTCAGG + Intronic
932791126 2:74654915-74654937 GATGGACCCAGGTGTATGTGCGG - Intronic
933296701 2:80499034-80499056 GATTGAGACAAGTCTATGTGGGG + Intronic
936603377 2:113922687-113922709 GATATAGGCAAGTTTATGTTAGG + Intronic
937269026 2:120635674-120635696 GATGTAGTCAAGTTAAGATGAGG + Intergenic
939617655 2:144378830-144378852 GATGTAATCAAGTTAATATGAGG - Intergenic
942143075 2:172997368-172997390 GATGTGGTCAAGTTAAGGTGAGG - Intronic
945640036 2:212413389-212413411 GATATAGCCAGGTGTATATGTGG - Intronic
945675791 2:212854143-212854165 GATATAGTCATGTGTATGGAGGG - Intergenic
946351418 2:219156978-219157000 GATGTAGAGATGTGTAAGTGAGG - Intronic
946375493 2:219306461-219306483 GATGGAGTCAAGAGTTGGTGAGG - Intronic
947505578 2:230705898-230705920 GATTTAGTCAAGTGAAGATGGGG - Intergenic
947816763 2:233042601-233042623 GATGTGGTCAGGAGTAAGTGGGG + Intergenic
1169763658 20:9125066-9125088 GATGGAGTCAAGCGTATTTCAGG - Intronic
1171278373 20:23877327-23877349 GATGTATTCATGTGCATGGGAGG - Intronic
1171988971 20:31681057-31681079 GCTGAAGTCCAGTGAATGTGAGG + Intronic
1175285665 20:57835071-57835093 GATGTAATCAAGTGAAGATGAGG - Intergenic
1177383534 21:20377707-20377729 GATGTGATTATGTGTATGTGGGG - Intergenic
1178940553 21:36901765-36901787 GATGTAATCAAGTGAAGATGAGG - Intronic
1184608364 22:45587061-45587083 GATGTTGTCAATGGGATGTGAGG + Intronic
950979804 3:17289927-17289949 GATATAGTTAAGTGTATATGTGG - Intronic
952278552 3:31901658-31901680 CATGCAGTCTAGTGAATGTGTGG - Intronic
953182025 3:40604783-40604805 GAGGTAAGCATGTGTATGTGGGG - Intergenic
954569018 3:51625081-51625103 TATGTAGTCAAGTGTCTTTGGGG - Intronic
955404339 3:58616453-58616475 GATGTAGTCAAGTTAAGATGAGG + Intronic
957134453 3:76267875-76267897 GATGTAGTAATGTGGATGTGAGG - Intronic
958702591 3:97613617-97613639 AGTGTAGTCAAGTGTGTGTGTGG + Intronic
959919629 3:111856652-111856674 TGTGTAGTCAAGTGTATTTCTGG + Intronic
961220951 3:125199310-125199332 GACTGAGTCAAGAGTATGTGGGG + Intronic
965800139 3:172483957-172483979 CCTATACTCAAGTGTATGTGAGG - Intergenic
966043532 3:175521569-175521591 GATGTAATCAAGTGAAAATGAGG + Intronic
969028090 4:4190630-4190652 GATGTCTTAAAGTGTATGGGAGG + Intronic
970221861 4:13820030-13820052 GATGTAATCAAGTTGATATGAGG + Intergenic
973286138 4:48419064-48419086 GTTGTAGTCAAGTCTTTGTGTGG + Intronic
974836993 4:67263046-67263068 GATGTAATCAAGTGAAGATGAGG - Intergenic
975188683 4:71434145-71434167 GATGTACTCAACTGTTGGTGTGG + Intronic
976556815 4:86460206-86460228 TATGTAGTTAAGTTTATTTGGGG - Intronic
979171947 4:117611131-117611153 GATATAGACACTTGTATGTGAGG - Intergenic
980498777 4:133620721-133620743 GATGTTGTCTAGAGTATGTCAGG + Intergenic
980810020 4:137865857-137865879 TATACAGTCAAGTCTATGTGTGG + Intergenic
981472183 4:145149096-145149118 GATGTAATCAAGTTAAGGTGAGG + Intronic
982375982 4:154691346-154691368 AATGTAGTGGAGTGTATTTGTGG - Intronic
985417907 4:189755116-189755138 GATGTAGGTAAGTGAATTTGGGG + Intergenic
986121810 5:4845963-4845985 GATGTACTCATGTGTATGCCTGG - Intergenic
986349656 5:6866016-6866038 GATGTAACCAAGTGAAGGTGAGG + Intergenic
986816429 5:11417299-11417321 GATGTAGCCAAATGTATGACTGG - Intronic
990501896 5:56404900-56404922 GATGAAGTTAAATTTATGTGAGG + Intergenic
992778528 5:80108186-80108208 TATTTAGTCCATTGTATGTGTGG - Intergenic
997108611 5:131049234-131049256 GATGTAATCCAGTTAATGTGAGG + Intergenic
999104225 5:149055509-149055531 GATAAAGCCAAGTGTTTGTGAGG + Intronic
999402502 5:151277003-151277025 GATTTAGAAAAGTGTATGTTGGG - Intronic
1004567204 6:16808907-16808929 GATGTAATCAAGTGAAGTTGAGG - Intergenic
1007050173 6:38819480-38819502 GCTGTATTTAAGTCTATGTGTGG - Intronic
1007077413 6:39076685-39076707 TATGTAGACATGTGTGTGTGAGG - Intronic
1010454825 6:76042932-76042954 GATGTAGTAAAGCTTTTGTGAGG - Intronic
1011850502 6:91621965-91621987 TAAGTAGACAAGAGTATGTGGGG - Intergenic
1013593768 6:111643530-111643552 GATGTTGAGAAGTGTGTGTGGGG + Intergenic
1015697249 6:135994423-135994445 GATGGAGTCAAATGTATCTTTGG - Intronic
1016549802 6:145266643-145266665 TGTGTATTCATGTGTATGTGTGG - Intergenic
1021796574 7:24260885-24260907 GATGTAGTGGTGTGTATCTGTGG + Intergenic
1023345855 7:39270587-39270609 CAGGTAATGAAGTGTATGTGGGG + Intronic
1024743131 7:52376813-52376835 AATGTAGTCAAGTCTCAGTGAGG + Intergenic
1024866339 7:53908104-53908126 GAGGTAAGAAAGTGTATGTGTGG + Intergenic
1024886792 7:54151458-54151480 CATGCAGTCATGTGAATGTGTGG - Intergenic
1028538508 7:91916167-91916189 GATGTGGTCAAATGCTTGTGAGG + Intergenic
1028572700 7:92308817-92308839 GATGTATTTAAGTATGTGTGAGG + Intronic
1034898204 7:154891089-154891111 GACGTAGTCATGTGTACCTGTGG + Intronic
1036786217 8:11689487-11689509 AAGGTAGCCAAGTGTGTGTGGGG - Intronic
1037383903 8:18317381-18317403 TATCTAATCAAGTGTATGTGGGG - Intergenic
1041234381 8:55784689-55784711 GTTGTATTGAAGTGTCTGTGAGG + Intronic
1041564452 8:59261214-59261236 GATGTGGTCAAATATATTTGGGG - Intergenic
1042889129 8:73587600-73587622 GATGTAGAAAAGTGTATGTGTGG + Intronic
1043517079 8:81004876-81004898 GCTGTGGTCAAGTGCATGCGTGG - Intronic
1046951559 8:120024480-120024502 GAGGTAGTCAAGTTTAGATGAGG + Intronic
1047912846 8:129549399-129549421 TATGTAGTTGTGTGTATGTGTGG - Intergenic
1048193250 8:132309531-132309553 GATGTAGTCCAGGGTGTTTGGGG - Intronic
1048194185 8:132318658-132318680 GATGTAGTTTAGTGTGTTTGGGG + Intronic
1048380116 8:133858146-133858168 GATGTAGTCAAGTTAAGATGGGG - Intergenic
1050017221 9:1246815-1246837 TATGAACTCAAGTGTATGGGTGG + Intergenic
1050206615 9:3203039-3203061 GATGTAATCAAGTTAAGGTGAGG - Intergenic
1050663574 9:7910364-7910386 CATGTGGACAAGTGTTTGTGTGG - Intergenic
1051430827 9:16978539-16978561 GAAGAAATCAAGTGTAGGTGGGG - Intergenic
1052399161 9:27978798-27978820 GCTGTAGTAAAATGTGTGTGGGG - Intronic
1053065768 9:35067879-35067901 GATGTCATCAGGTGTGTGTGGGG - Exonic
1055231501 9:74072422-74072444 TATGTAGTTAAGTGTGTTTGTGG + Intergenic
1055247885 9:74268750-74268772 CAAGTAGTCAAGAGCATGTGTGG + Intergenic
1057528184 9:95820860-95820882 TCTGTAGTAAAGTGTATCTGTGG - Intergenic
1058169161 9:101658212-101658234 GATGCAGTAAAGTTTAAGTGAGG + Intronic
1186552581 X:10522156-10522178 GATGTAATCAAGTTAAAGTGAGG + Intronic
1187853747 X:23616766-23616788 GATGTAGTCAAGTTAAAATGAGG + Intergenic
1188786888 X:34357664-34357686 GATGAGGTCATGTGTATGTTTGG - Intergenic
1189569087 X:42275990-42276012 GATGTAGTCAAGTTAAGATGAGG + Intergenic
1192783135 X:74314190-74314212 GATGAAGCCAAGTGTATGGCTGG - Intergenic
1194463241 X:94198378-94198400 CATGTATGTAAGTGTATGTGTGG - Intergenic
1197322170 X:125045894-125045916 GGTGTACTGAAGTGTATGTAGGG - Intergenic
1198079494 X:133225766-133225788 TATGTAGGGATGTGTATGTGTGG + Intergenic
1198298387 X:135309388-135309410 CATGTAATCAAGTGGATCTGGGG - Intronic
1198308959 X:135411305-135411327 GATCTATGCAAGTGTATTTGGGG - Intergenic
1198484173 X:137069932-137069954 GATGGAGTGAAATCTATGTGTGG - Intergenic
1199164938 X:144660588-144660610 GATTTTGTCAAGTATCTGTGAGG - Intergenic
1202604904 Y:26630865-26630887 AATGTACTCAAGTGTAGCTGAGG + Intergenic