ID: 1068586528 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:58805902-58805924 |
Sequence | GATGTAGTCAAGTGTATGTG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1068586528_1068586530 | 15 | Left | 1068586528 | 10:58805902-58805924 | CCTCACATACACTTGACTACATC | No data | ||
Right | 1068586530 | 10:58805940-58805962 | GTTTTAATGGAATGAATCAATGG | No data | ||||
1068586528_1068586529 | 2 | Left | 1068586528 | 10:58805902-58805924 | CCTCACATACACTTGACTACATC | No data | ||
Right | 1068586529 | 10:58805927-58805949 | AGTTACTCATTCAGTTTTAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1068586528 | Original CRISPR | GATGTAGTCAAGTGTATGTG AGG (reversed) | Intronic | ||