ID: 1068586529

View in Genome Browser
Species Human (GRCh38)
Location 10:58805927-58805949
Sequence AGTTACTCATTCAGTTTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068586528_1068586529 2 Left 1068586528 10:58805902-58805924 CCTCACATACACTTGACTACATC No data
Right 1068586529 10:58805927-58805949 AGTTACTCATTCAGTTTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068586529 Original CRISPR AGTTACTCATTCAGTTTTAA TGG Intronic