ID: 1068586530

View in Genome Browser
Species Human (GRCh38)
Location 10:58805940-58805962
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068586528_1068586530 15 Left 1068586528 10:58805902-58805924 CCTCACATACACTTGACTACATC No data
Right 1068586530 10:58805940-58805962 GTTTTAATGGAATGAATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type