ID: 1068601604

View in Genome Browser
Species Human (GRCh38)
Location 10:58963083-58963105
Sequence CCATTGGTATAGAGGAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068601604_1068601612 14 Left 1068601604 10:58963083-58963105 CCACCTTTCCTCTATACCAATGG No data
Right 1068601612 10:58963120-58963142 CAATTTTGTCCCCAGAGAACAGG No data
1068601604_1068601617 27 Left 1068601604 10:58963083-58963105 CCACCTTTCCTCTATACCAATGG No data
Right 1068601617 10:58963133-58963155 AGAGAACAGGTGGCAATTCCTGG No data
1068601604_1068601613 17 Left 1068601604 10:58963083-58963105 CCACCTTTCCTCTATACCAATGG No data
Right 1068601613 10:58963123-58963145 TTTTGTCCCCAGAGAACAGGTGG No data
1068601604_1068601609 -9 Left 1068601604 10:58963083-58963105 CCACCTTTCCTCTATACCAATGG No data
Right 1068601609 10:58963097-58963119 TACCAATGGTTCCTAACTGAGGG No data
1068601604_1068601608 -10 Left 1068601604 10:58963083-58963105 CCACCTTTCCTCTATACCAATGG No data
Right 1068601608 10:58963096-58963118 ATACCAATGGTTCCTAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068601604 Original CRISPR CCATTGGTATAGAGGAAAGG TGG (reversed) Intergenic
No off target data available for this crispr