ID: 1068604512

View in Genome Browser
Species Human (GRCh38)
Location 10:58990424-58990446
Sequence ACTAGACAGTGCCTCAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068604512_1068604518 -5 Left 1068604512 10:58990424-58990446 CCCCCACTGAGGCACTGTCTAGT No data
Right 1068604518 10:58990442-58990464 CTAGTGGAGCTGTGAGTAGAGGG No data
1068604512_1068604521 21 Left 1068604512 10:58990424-58990446 CCCCCACTGAGGCACTGTCTAGT No data
Right 1068604521 10:58990468-58990490 CCATCCTCCAGATCCCAGAATGG 0: 84
1: 897
2: 1365
3: 1641
4: 1510
1068604512_1068604517 -6 Left 1068604512 10:58990424-58990446 CCCCCACTGAGGCACTGTCTAGT No data
Right 1068604517 10:58990441-58990463 TCTAGTGGAGCTGTGAGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068604512 Original CRISPR ACTAGACAGTGCCTCAGTGG GGG (reversed) Intergenic
No off target data available for this crispr