ID: 1068604517

View in Genome Browser
Species Human (GRCh38)
Location 10:58990441-58990463
Sequence TCTAGTGGAGCTGTGAGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068604516_1068604517 -9 Left 1068604516 10:58990427-58990449 CCACTGAGGCACTGTCTAGTGGA No data
Right 1068604517 10:58990441-58990463 TCTAGTGGAGCTGTGAGTAGAGG No data
1068604514_1068604517 -8 Left 1068604514 10:58990426-58990448 CCCACTGAGGCACTGTCTAGTGG No data
Right 1068604517 10:58990441-58990463 TCTAGTGGAGCTGTGAGTAGAGG No data
1068604512_1068604517 -6 Left 1068604512 10:58990424-58990446 CCCCCACTGAGGCACTGTCTAGT No data
Right 1068604517 10:58990441-58990463 TCTAGTGGAGCTGTGAGTAGAGG No data
1068604513_1068604517 -7 Left 1068604513 10:58990425-58990447 CCCCACTGAGGCACTGTCTAGTG No data
Right 1068604517 10:58990441-58990463 TCTAGTGGAGCTGTGAGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068604517 Original CRISPR TCTAGTGGAGCTGTGAGTAG AGG Intergenic
No off target data available for this crispr