ID: 1068604521

View in Genome Browser
Species Human (GRCh38)
Location 10:58990468-58990490
Sequence CCATCCTCCAGATCCCAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5497
Summary {0: 84, 1: 897, 2: 1365, 3: 1641, 4: 1510}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068604516_1068604521 18 Left 1068604516 10:58990427-58990449 CCACTGAGGCACTGTCTAGTGGA No data
Right 1068604521 10:58990468-58990490 CCATCCTCCAGATCCCAGAATGG 0: 84
1: 897
2: 1365
3: 1641
4: 1510
1068604514_1068604521 19 Left 1068604514 10:58990426-58990448 CCCACTGAGGCACTGTCTAGTGG No data
Right 1068604521 10:58990468-58990490 CCATCCTCCAGATCCCAGAATGG 0: 84
1: 897
2: 1365
3: 1641
4: 1510
1068604513_1068604521 20 Left 1068604513 10:58990425-58990447 CCCCACTGAGGCACTGTCTAGTG No data
Right 1068604521 10:58990468-58990490 CCATCCTCCAGATCCCAGAATGG 0: 84
1: 897
2: 1365
3: 1641
4: 1510
1068604512_1068604521 21 Left 1068604512 10:58990424-58990446 CCCCCACTGAGGCACTGTCTAGT No data
Right 1068604521 10:58990468-58990490 CCATCCTCCAGATCCCAGAATGG 0: 84
1: 897
2: 1365
3: 1641
4: 1510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068604521 Original CRISPR CCATCCTCCAGATCCCAGAA TGG Intergenic
Too many off-targets to display for this crispr