ID: 1068607770

View in Genome Browser
Species Human (GRCh38)
Location 10:59024906-59024928
Sequence CTCATTATAATTGCTGTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068607770_1068607774 28 Left 1068607770 10:59024906-59024928 CCTCAGACAGCAATTATAATGAG No data
Right 1068607774 10:59024957-59024979 GACAAGAGTAGCCTCATATAAGG No data
1068607770_1068607773 -2 Left 1068607770 10:59024906-59024928 CCTCAGACAGCAATTATAATGAG No data
Right 1068607773 10:59024927-59024949 AGCTGCAGGCATGCAGGTCAAGG No data
1068607770_1068607772 -8 Left 1068607770 10:59024906-59024928 CCTCAGACAGCAATTATAATGAG No data
Right 1068607772 10:59024921-59024943 ATAATGAGCTGCAGGCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068607770 Original CRISPR CTCATTATAATTGCTGTCTG AGG (reversed) Intergenic
No off target data available for this crispr