ID: 1068608571

View in Genome Browser
Species Human (GRCh38)
Location 10:59033537-59033559
Sequence CTATTTTCACCTGCTAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068608571_1068608582 29 Left 1068608571 10:59033537-59033559 CCTCAGTTAGCAGGTGAAAATAG No data
Right 1068608582 10:59033589-59033611 CCACTCTTTTTGGCATATACAGG No data
1068608571_1068608576 2 Left 1068608571 10:59033537-59033559 CCTCAGTTAGCAGGTGAAAATAG No data
Right 1068608576 10:59033562-59033584 AAAGACTTGCTGGAGGGAATGGG No data
1068608571_1068608572 -8 Left 1068608571 10:59033537-59033559 CCTCAGTTAGCAGGTGAAAATAG No data
Right 1068608572 10:59033552-59033574 GAAAATAGTGAAAGACTTGCTGG No data
1068608571_1068608575 1 Left 1068608571 10:59033537-59033559 CCTCAGTTAGCAGGTGAAAATAG No data
Right 1068608575 10:59033561-59033583 GAAAGACTTGCTGGAGGGAATGG No data
1068608571_1068608574 -4 Left 1068608571 10:59033537-59033559 CCTCAGTTAGCAGGTGAAAATAG No data
Right 1068608574 10:59033556-59033578 ATAGTGAAAGACTTGCTGGAGGG No data
1068608571_1068608577 3 Left 1068608571 10:59033537-59033559 CCTCAGTTAGCAGGTGAAAATAG No data
Right 1068608577 10:59033563-59033585 AAGACTTGCTGGAGGGAATGGGG No data
1068608571_1068608579 19 Left 1068608571 10:59033537-59033559 CCTCAGTTAGCAGGTGAAAATAG No data
Right 1068608579 10:59033579-59033601 AATGGGGGTCCCACTCTTTTTGG No data
1068608571_1068608573 -5 Left 1068608571 10:59033537-59033559 CCTCAGTTAGCAGGTGAAAATAG No data
Right 1068608573 10:59033555-59033577 AATAGTGAAAGACTTGCTGGAGG No data
1068608571_1068608578 4 Left 1068608571 10:59033537-59033559 CCTCAGTTAGCAGGTGAAAATAG No data
Right 1068608578 10:59033564-59033586 AGACTTGCTGGAGGGAATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068608571 Original CRISPR CTATTTTCACCTGCTAACTG AGG (reversed) Intergenic
No off target data available for this crispr