ID: 1068608582

View in Genome Browser
Species Human (GRCh38)
Location 10:59033589-59033611
Sequence CCACTCTTTTTGGCATATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068608571_1068608582 29 Left 1068608571 10:59033537-59033559 CCTCAGTTAGCAGGTGAAAATAG No data
Right 1068608582 10:59033589-59033611 CCACTCTTTTTGGCATATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068608582 Original CRISPR CCACTCTTTTTGGCATATAC AGG Intergenic
No off target data available for this crispr