ID: 1068608763

View in Genome Browser
Species Human (GRCh38)
Location 10:59035358-59035380
Sequence GAAAGGCAAACCAGATTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068608763_1068608766 10 Left 1068608763 10:59035358-59035380 CCTGGGAATCTGGTTTGCCTTTC No data
Right 1068608766 10:59035391-59035413 AGAAAACTGGAATTCAATATTGG No data
1068608763_1068608767 30 Left 1068608763 10:59035358-59035380 CCTGGGAATCTGGTTTGCCTTTC No data
Right 1068608767 10:59035411-59035433 TGGAATTATGCCCATAGAGTTGG No data
1068608763_1068608765 -3 Left 1068608763 10:59035358-59035380 CCTGGGAATCTGGTTTGCCTTTC No data
Right 1068608765 10:59035378-59035400 TTCTTATTATCAAAGAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068608763 Original CRISPR GAAAGGCAAACCAGATTCCC AGG (reversed) Intergenic
No off target data available for this crispr