ID: 1068608767

View in Genome Browser
Species Human (GRCh38)
Location 10:59035411-59035433
Sequence TGGAATTATGCCCATAGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068608764_1068608767 13 Left 1068608764 10:59035375-59035397 CCTTTCTTATTATCAAAGAAAAC No data
Right 1068608767 10:59035411-59035433 TGGAATTATGCCCATAGAGTTGG No data
1068608763_1068608767 30 Left 1068608763 10:59035358-59035380 CCTGGGAATCTGGTTTGCCTTTC No data
Right 1068608767 10:59035411-59035433 TGGAATTATGCCCATAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068608767 Original CRISPR TGGAATTATGCCCATAGAGT TGG Intergenic
No off target data available for this crispr