ID: 1068611650

View in Genome Browser
Species Human (GRCh38)
Location 10:59066951-59066973
Sequence CACTCTATGAAGAATTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068611650_1068611658 25 Left 1068611650 10:59066951-59066973 CCCTCCAAATTCTTCATAGAGTG No data
Right 1068611658 10:59066999-59067021 CATCTGGTTTAGGCTGTTCTAGG No data
1068611650_1068611655 9 Left 1068611650 10:59066951-59066973 CCCTCCAAATTCTTCATAGAGTG No data
Right 1068611655 10:59066983-59067005 AATAAAGGTTGAGGACCATCTGG No data
1068611650_1068611659 29 Left 1068611650 10:59066951-59066973 CCCTCCAAATTCTTCATAGAGTG No data
Right 1068611659 10:59067003-59067025 TGGTTTAGGCTGTTCTAGGCAGG No data
1068611650_1068611660 30 Left 1068611650 10:59066951-59066973 CCCTCCAAATTCTTCATAGAGTG No data
Right 1068611660 10:59067004-59067026 GGTTTAGGCTGTTCTAGGCAGGG No data
1068611650_1068611656 15 Left 1068611650 10:59066951-59066973 CCCTCCAAATTCTTCATAGAGTG No data
Right 1068611656 10:59066989-59067011 GGTTGAGGACCATCTGGTTTAGG No data
1068611650_1068611653 -6 Left 1068611650 10:59066951-59066973 CCCTCCAAATTCTTCATAGAGTG No data
Right 1068611653 10:59066968-59066990 AGAGTGATTGTGATGAATAAAGG No data
1068611650_1068611654 0 Left 1068611650 10:59066951-59066973 CCCTCCAAATTCTTCATAGAGTG No data
Right 1068611654 10:59066974-59066996 ATTGTGATGAATAAAGGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068611650 Original CRISPR CACTCTATGAAGAATTTGGA GGG (reversed) Intergenic
No off target data available for this crispr